--- /dev/null
+=head1 NAME
+
+perlretut - Perl regular expressions tutorial
+
+=head1 DESCRIPTION
+
+This page provides a basic tutorial on understanding, creating and
+using regular expressions in Perl. It serves as a complement to the
+reference page on regular expressions L<perlre>. Regular expressions
+are an integral part of the C<m//>, C<s///>, C<qr//> and C<split>
+operators and so this tutorial also overlaps with
+L<perlop/"Regexp Quote-Like Operators"> and L<perlfunc/split>.
+
+Perl is widely renowned for excellence in text processing, and regular
+expressions are one of the big factors behind this fame. Perl regular
+expressions display an efficiency and flexibility unknown in most
+other computer languages. Mastering even the basics of regular
+expressions will allow you to manipulate text with surprising ease.
+
+What is a regular expression? A regular expression is simply a string
+that describes a pattern. Patterns are in common use these days;
+examples are the patterns typed into a search engine to find web pages
+and the patterns used to list files in a directory, e.g., C<ls *.txt>
+or C<dir *.*>. In Perl, the patterns described by regular expressions
+are used to search strings, extract desired parts of strings, and to
+do search and replace operations.
+
+Regular expressions have the undeserved reputation of being abstract
+and difficult to understand. Regular expressions are constructed using
+simple concepts like conditionals and loops and are no more difficult
+to understand than the corresponding C<if> conditionals and C<while>
+loops in the Perl language itself. In fact, the main challenge in
+learning regular expressions is just getting used to the terse
+notation used to express these concepts.
+
+This tutorial flattens the learning curve by discussing regular
+expression concepts, along with their notation, one at a time and with
+many examples. The first part of the tutorial will progress from the
+simplest word searches to the basic regular expression concepts. If
+you master the first part, you will have all the tools needed to solve
+about 98% of your needs. The second part of the tutorial is for those
+comfortable with the basics and hungry for more power tools. It
+discusses the more advanced regular expression operators and
+introduces the latest cutting edge innovations in 5.6.0.
+
+A note: to save time, 'regular expression' is often abbreviated as
+regexp or regex. Regexp is a more natural abbreviation than regex, but
+is harder to pronounce. The Perl pod documentation is evenly split on
+regexp vs regex; in Perl, there is more than one way to abbreviate it.
+We'll use regexp in this tutorial.
+
+=head1 Part 1: The basics
+
+=head2 Simple word matching
+
+The simplest regexp is simply a word, or more generally, a string of
+characters. A regexp consisting of a word matches any string that
+contains that word:
+
+ "Hello World" =~ /World/; # matches
+
+What is this perl statement all about? C<"Hello World"> is a simple
+double quoted string. C<World> is the regular expression and the
+C<//> enclosing C</World/> tells perl to search a string for a match.
+The operator C<=~> associates the string with the regexp match and
+produces a true value if the regexp matched, or false if the regexp
+did not match. In our case, C<World> matches the second word in
+C<"Hello World">, so the expression is true. Expressions like this
+are useful in conditionals:
+
+ if ("Hello World" =~ /World/) {
+ print "It matches\n";
+ }
+ else {
+ print "It doesn't match\n";
+ }
+
+There are useful variations on this theme. The sense of the match can
+be reversed by using C<!~> operator:
+
+ if ("Hello World" !~ /World/) {
+ print "It doesn't match\n";
+ }
+ else {
+ print "It matches\n";
+ }
+
+The literal string in the regexp can be replaced by a variable:
+
+ $greeting = "World";
+ if ("Hello World" =~ /$greeting/) {
+ print "It matches\n";
+ }
+ else {
+ print "It doesn't match\n";
+ }
+
+If you're matching against the special default variable C<$_>, the
+C<$_ =~> part can be omitted:
+
+ $_ = "Hello World";
+ if (/World/) {
+ print "It matches\n";
+ }
+ else {
+ print "It doesn't match\n";
+ }
+
+And finally, the C<//> default delimiters for a match can be changed
+to arbitrary delimiters by putting an C<'m'> out front:
+
+ "Hello World" =~ m!World!; # matches, delimited by '!'
+ "Hello World" =~ m{World}; # matches, note the matching '{}'
+ "/usr/bin/perl" =~ m"/perl"; # matches, '/' becomes ordinary char
+
+C</World/>, C<m!World!>, and C<m{World}> all represent the
+same thing. When, e.g., C<""> is used as a delimiter, the forward
+slash C<'/'> becomes an ordinary character and can be used in a regexp
+without trouble.
+
+Let's consider how different regexps would match C<"Hello World">:
+
+ "Hello World" =~ /world/; # doesn't match
+ "Hello World" =~ /o W/; # matches
+ "Hello World" =~ /oW/; # doesn't match
+ "Hello World" =~ /World /; # doesn't match
+
+The first regexp C<world> doesn't match because regexps are
+case-sensitive. The second regexp matches because the substring
+S<C<'o W'> > occurs in the string S<C<"Hello World"> >. The space
+character ' ' is treated like any other character in a regexp and is
+needed to match in this case. The lack of a space character is the
+reason the third regexp C<'oW'> doesn't match. The fourth regexp
+C<'World '> doesn't match because there is a space at the end of the
+regexp, but not at the end of the string. The lesson here is that
+regexps must match a part of the string I<exactly> in order for the
+statement to be true.
+
+If a regexp matches in more than one place in the string, perl will
+always match at the earliest possible point in the string:
+
+ "Hello World" =~ /o/; # matches 'o' in 'Hello'
+ "That hat is red" =~ /hat/; # matches 'hat' in 'That'
+
+With respect to character matching, there are a few more points you
+need to know about. First of all, not all characters can be used 'as
+is' in a match. Some characters, called B<metacharacters>, are reserved
+for use in regexp notation. The metacharacters are
+
+ {}[]()^$.|*+?\
+
+The significance of each of these will be explained
+in the rest of the tutorial, but for now, it is important only to know
+that a metacharacter can be matched by putting a backslash before it:
+
+ "2+2=4" =~ /2+2/; # doesn't match, + is a metacharacter
+ "2+2=4" =~ /2\+2/; # matches, \+ is treated like an ordinary +
+ "The interval is [0,1)." =~ /[0,1)./ # is a syntax error!
+ "The interval is [0,1)." =~ /\[0,1\)\./ # matches
+ "/usr/bin/perl" =~ /\/usr\/local\/bin\/perl/; # matches
+
+In the last regexp, the forward slash C<'/'> is also backslashed,
+because it is used to delimit the regexp. This can lead to LTS
+(leaning toothpick syndrome), however, and it is often more readable
+to change delimiters.
+
+
+The backslash character C<'\'> is a metacharacter itself and needs to
+be backslashed:
+
+ 'C:\WIN32' =~ /C:\\WIN/; # matches
+
+In addition to the metacharacters, there are some ASCII characters
+which don't have printable character equivalents and are instead
+represented by B<escape sequences>. Common examples are C<\t> for a
+tab, C<\n> for a newline, C<\r> for a carriage return and C<\a> for a
+bell. If your string is better thought of as a sequence of arbitrary
+bytes, the octal escape sequence, e.g., C<\033>, or hexadecimal escape
+sequence, e.g., C<\x1B> may be a more natural representation for your
+bytes. Here are some examples of escapes:
+
+ "1000\t2000" =~ m(0\t2) # matches
+ "1000\n2000" =~ /0\n20/ # matches
+ "1000\t2000" =~ /\000\t2/ # doesn't match, "0" ne "\000"
+ "cat" =~ /\143\x61\x74/ # matches, but a weird way to spell cat
+
+If you've been around Perl a while, all this talk of escape sequences
+may seem familiar. Similar escape sequences are used in double-quoted
+strings and in fact the regexps in Perl are mostly treated as
+double-quoted strings. This means that variables can be used in
+regexps as well. Just like double-quoted strings, the values of the
+variables in the regexp will be substituted in before the regexp is
+evaluated for matching purposes. So we have:
+
+ $foo = 'house';
+ 'housecat' =~ /$foo/; # matches
+ 'cathouse' =~ /cat$foo/; # matches
+ 'housecat' =~ /$foocat/; # doesn't match, there is no $foocat
+ 'housecat' =~ /${foo}cat/; # matches
+
+So far, so good. With the knowledge above you can already perform
+searches with just about any literal string regexp you can dream up.
+Here is a I<very simple> emulation of the Unix grep program:
+
+ % cat > simple_grep
+ #!/usr/bin/perl
+ $regexp = shift;
+ while (<>) {
+ print if /$regexp/;
+ }
+ ^D
+
+ % chmod +x simple_grep
+
+ % simple_grep abba /usr/dict/words
+ Babbage
+ cabbage
+ cabbages
+ sabbath
+ Sabbathize
+ Sabbathizes
+ sabbatical
+ scabbard
+ scabbards
+
+This program is easy to understand. C<#!/usr/bin/perl> is the standard
+way to invoke a perl program from the shell.
+S<C<$regexp = shift;> > saves the first command line argument as the
+regexp to be used, leaving the rest of the command line arguments to
+be treated as files. S<C<< while (<>) >> > loops over all the lines in
+all the files. For each line, S<C<print if /$regexp/;> > prints the
+line if the regexp matches the line. In this line, both C<print> and
+C</$regexp/> use the default variable C<$_> implicitly.
+
+With all of the regexps above, if the regexp matched anywhere in the
+string, it was considered a match. Sometimes, however, we'd like to
+specify I<where> in the string the regexp should try to match. To do
+this, we would use the B<anchor> metacharacters C<^> and C<$>. The
+anchor C<^> means match at the beginning of the string and the anchor
+C<$> means match at the end of the string, or before a newline at the
+end of the string. Here is how they are used:
+
+ "housekeeper" =~ /keeper/; # matches
+ "housekeeper" =~ /^keeper/; # doesn't match
+ "housekeeper" =~ /keeper$/; # matches
+ "housekeeper\n" =~ /keeper$/; # matches
+
+The second regexp doesn't match because C<^> constrains C<keeper> to
+match only at the beginning of the string, but C<"housekeeper"> has
+keeper starting in the middle. The third regexp does match, since the
+C<$> constrains C<keeper> to match only at the end of the string.
+
+When both C<^> and C<$> are used at the same time, the regexp has to
+match both the beginning and the end of the string, i.e., the regexp
+matches the whole string. Consider
+
+ "keeper" =~ /^keep$/; # doesn't match
+ "keeper" =~ /^keeper$/; # matches
+ "" =~ /^$/; # ^$ matches an empty string
+
+The first regexp doesn't match because the string has more to it than
+C<keep>. Since the second regexp is exactly the string, it
+matches. Using both C<^> and C<$> in a regexp forces the complete
+string to match, so it gives you complete control over which strings
+match and which don't. Suppose you are looking for a fellow named
+bert, off in a string by himself:
+
+ "dogbert" =~ /bert/; # matches, but not what you want
+
+ "dilbert" =~ /^bert/; # doesn't match, but ..
+ "bertram" =~ /^bert/; # matches, so still not good enough
+
+ "bertram" =~ /^bert$/; # doesn't match, good
+ "dilbert" =~ /^bert$/; # doesn't match, good
+ "bert" =~ /^bert$/; # matches, perfect
+
+Of course, in the case of a literal string, one could just as easily
+use the string equivalence S<C<$string eq 'bert'> > and it would be
+more efficient. The C<^...$> regexp really becomes useful when we
+add in the more powerful regexp tools below.
+
+=head2 Using character classes
+
+Although one can already do quite a lot with the literal string
+regexps above, we've only scratched the surface of regular expression
+technology. In this and subsequent sections we will introduce regexp
+concepts (and associated metacharacter notations) that will allow a
+regexp to not just represent a single character sequence, but a I<whole
+class> of them.
+
+One such concept is that of a B<character class>. A character class
+allows a set of possible characters, rather than just a single
+character, to match at a particular point in a regexp. Character
+classes are denoted by brackets C<[...]>, with the set of characters
+to be possibly matched inside. Here are some examples:
+
+ /cat/; # matches 'cat'
+ /[bcr]at/; # matches 'bat, 'cat', or 'rat'
+ /item[0123456789]/; # matches 'item0' or ... or 'item9'
+ "abc" =~ /[cab/; # matches 'a'
+
+In the last statement, even though C<'c'> is the first character in
+the class, C<'a'> matches because the first character position in the
+string is the earliest point at which the regexp can match.
+
+ /[yY][eE][sS]/; # match 'yes' in a case-insensitive way
+ # 'yes', 'Yes', 'YES', etc.
+
+This regexp displays a common task: perform a a case-insensitive
+match. Perl provides away of avoiding all those brackets by simply
+appending an C<'i'> to the end of the match. Then C</[yY][eE][sS]/;>
+can be rewritten as C</yes/i;>. The C<'i'> stands for
+case-insensitive and is an example of a B<modifier> of the matching
+operation. We will meet other modifiers later in the tutorial.
+
+We saw in the section above that there were ordinary characters, which
+represented themselves, and special characters, which needed a
+backslash C<\> to represent themselves. The same is true in a
+character class, but the sets of ordinary and special characters
+inside a character class are different than those outside a character
+class. The special characters for a character class are C<-]\^$>. C<]>
+is special because it denotes the end of a character class. C<$> is
+special because it denotes a scalar variable. C<\> is special because
+it is used in escape sequences, just like above. Here is how the
+special characters C<]$\> are handled:
+
+ /[\]c]def/; # matches ']def' or 'cdef'
+ $x = 'bcr';
+ /[$x]at/; # matches 'bat, 'cat', or 'rat'
+ /[\$x]at/; # matches '$at' or 'xat'
+ /[\\$x]at/; # matches '\at', 'bat, 'cat', or 'rat'
+
+The last two are a little tricky. in C<[\$x]>, the backslash protects
+the dollar sign, so the character class has two members C<$> and C<x>.
+In C<[\\$x]>, the backslash is protected, so C<$x> is treated as a
+variable and substituted in double quote fashion.
+
+The special character C<'-'> acts as a range operator within character
+classes, so that a contiguous set of characters can be written as a
+range. With ranges, the unwieldy C<[0123456789]> and C<[abc...xyz]>
+become the svelte C<[0-9]> and C<[a-z]>. Some examples are
+
+ /item[0-9]/; # matches 'item0' or ... or 'item9'
+ /[0-9bx-z]aa/; # matches '0aa', ..., '9aa',
+ # 'baa', 'xaa', 'yaa', or 'zaa'
+ /[0-9a-fA-F]/; # matches a hexadecimal digit
+ /[0-9a-zA-Z_]/; # matches an alphanumeric character,
+ # like those in a perl variable name
+
+If C<'-'> is the first or last character in a character class, it is
+treated as an ordinary character; C<[-ab]>, C<[ab-]> and C<[a\-b]> are
+all equivalent.
+
+The special character C<^> in the first position of a character class
+denotes a B<negated character class>, which matches any character but
+those in the bracket. Both C<[...]> and C<[^...]> must match a
+character, or the match fails. Then
+
+ /[^a]at/; # doesn't match 'aat' or 'at', but matches
+ # all other 'bat', 'cat, '0at', '%at', etc.
+ /[^0-9]/; # matches a non-numeric character
+ /[a^]at/; # matches 'aat' or '^at'; here '^' is ordinary
+
+Now, even C<[0-9]> can be a bother the write multiple times, so in the
+interest of saving keystrokes and making regexps more readable, Perl
+has several abbreviations for common character classes:
+
+=over 4
+
+=item *
+\d is a digit and represents [0-9]
+
+=item *
+\s is a whitespace character and represents [\ \t\r\n\f]
+
+=item *
+\w is a word character (alphanumeric or _) and represents [0-9a-zA-Z_]
+
+=item *
+\D is a negated \d; it represents any character but a digit [^0-9]
+
+=item *
+\S is a negated \s; it represents any non-whitespace character [^\s]
+
+=item *
+\W is a negated \w; it represents any non-word character [^\w]
+
+=item *
+The period '.' matches any character but "\n"
+
+=back
+
+The C<\d\s\w\D\S\W> abbreviations can be used both inside and outside
+of character classes. Here are some in use:
+
+ /\d\d:\d\d:\d\d/; # matches a hh:mm:ss time format
+ /[\d\s]/; # matches any digit or whitespace character
+ /\w\W\w/; # matches a word char, followed by a
+ # non-word char, followed by a word char
+ /..rt/; # matches any two chars, followed by 'rt'
+ /end\./; # matches 'end.'
+ /end[.]/; # same thing, matches 'end.'
+
+Because a period is a metacharacter, it needs to be escaped to match
+as an ordinary period. Because, for example, C<\d> and C<\w> are sets
+of characters, it is incorrect to think of C<[^\d\w]> as C<[\D\W]>; in
+fact C<[^\d\w]> is the same as C<[^\w]>, which is the same as
+C<[\W]>. Think DeMorgan's laws.
+
+An anchor useful in basic regexps is the S<B<word anchor> >
+C<\b>. This matches a boundary between a word character and a non-word
+character C<\w\W> or C<\W\w>:
+
+ $x = "Housecat catenates house and cat";
+ $x =~ /cat/; # matches cat in 'housecat'
+ $x =~ /\bcat/; # matches cat in 'catenates'
+ $x =~ /cat\b/; # matches cat in 'housecat'
+ $x =~ /\bcat\b/; # matches 'cat' at end of string
+
+Note in the last example, the end of the string is considered a word
+boundary.
+
+You might wonder why C<'.'> matches everything but C<"\n"> - why not
+every character? The reason is that often one is matching against
+lines and would like to ignore the newline characters. For instance,
+while the string C<"\n"> represents one line, we would like to think
+of as empty. Then
+
+ "" =~ /^$/; # matches
+ "\n" =~ /^$/; # matches, "\n" is ignored
+
+ "" =~ /./; # doesn't match; it needs a char
+ "" =~ /^.$/; # doesn't match; it needs a char
+ "\n" =~ /^.$/; # doesn't match; it needs a char other than "\n"
+ "a" =~ /^.$/; # matches
+ "a\n" =~ /^.$/; # matches, ignores the "\n"
+
+This behavior is convenient, because we usually want to ignore
+newlines when we count and match characters in a line. Sometimes,
+however, we want to keep track of newlines. We might even want C<^>
+and C<$> to anchor at the beginning and end of lines within the
+string, rather than just the beginning and end of the string. Perl
+allows us to choose between ignoring and paying attention to newlines
+by using the C<//s> and C<//m> modifiers. C<//s> and C<//m> stand for
+single line and multi-line and they determine whether a string is to
+be treated as one continuous string, or as a set of lines. The two
+modifiers affect two aspects of how the regexp is interpreted: 1) how
+the C<'.'> character class is defined, and 2) where the anchors C<^>
+and C<$> are able to match. Here are the four possible combinations:
+
+=over 4
+
+=item *
+no modifiers (//): Default behavior. C<'.'> matches any character
+except C<"\n">. C<^> matches only at the beginning of the string and
+C<$> matches only at the end or before a newline at the end.
+
+=item *
+s modifier (//s): Treat string as a single long line. C<'.'> matches
+any character, even C<"\n">. C<^> matches only at the beginning of
+the string and C<$> matches only at the end or before a newline at the
+end.
+
+=item *
+m modifier (//m): Treat string as a set of multiple lines. C<'.'>
+matches any character except C<"\n">. C<^> and C<$> are able to match
+at the start or end of I<any> line within the string.
+
+=item *
+both s and m modifiers (//sm): Treat string as a single long line, but
+detect multiple lines. C<'.'> matches any character, even
+C<"\n">. C<^> and C<$>, however, are able to match at the start or end
+of I<any> line within the string.
+
+=back
+
+Here are examples of C<//s> and C<//m> in action:
+
+ $x = "There once was a girl\nWho programmed in Perl\n";
+
+ $x =~ /^Who/; # doesn't match, "Who" not at start of string
+ $x =~ /^Who/s; # doesn't match, "Who" not at start of string
+ $x =~ /^Who/m; # matches, "Who" at start of second line
+ $x =~ /^Who/sm; # matches, "Who" at start of second line
+
+ $x =~ /girl.Who/; # doesn't match, "." doesn't match "\n"
+ $x =~ /girl.Who/s; # matches, "." matches "\n"
+ $x =~ /girl.Who/m; # doesn't match, "." doesn't match "\n"
+ $x =~ /girl.Who/sm; # matches, "." matches "\n"
+
+Most of the time, the default behavior is what is want, but C<//s> and
+C<//m> are occasionally very useful. If C<//m> is being used, the start
+of the string can still be matched with C<\A> and the end of string
+can still be matched with the anchors C<\Z> (matches both the end and
+the newline before, like C<$>), and C<\z> (matches only the end):
+
+ $x =~ /^Who/m; # matches, "Who" at start of second line
+ $x =~ /\AWho/m; # doesn't match, "Who" is not at start of string
+
+ $x =~ /girl$/m; # matches, "girl" at end of first line
+ $x =~ /girl\Z/m; # doesn't match, "girl" is not at end of string
+
+ $x =~ /Perl\Z/m; # matches, "Perl" is at newline before end
+ $x =~ /Perl\z/m; # doesn't match, "Perl" is not at end of string
+
+We now know how to create choices among classes of characters in a
+regexp. What about choices among words or character strings? Such
+choices are described in the next section.
+
+=head2 Matching this or that
+
+Sometimes we would like to our regexp to be able to match different
+possible words or character strings. This is accomplished by using
+the B<alternation> metacharacter C<|>. To match C<dog> or C<cat>, we
+form the regexp C<dog|cat>. As before, perl will try to match the
+regexp at the earliest possible point in the string. At each
+character position, perl will first try to match the first
+alternative, C<dog>. If C<dog> doesn't match, perl will then try the
+next alternative, C<cat>. If C<cat> doesn't match either, then the
+match fails and perl moves to the next position in the string. Some
+examples:
+
+ "cats and dogs" =~ /cat|dog|bird/; # matches "cat"
+ "cats and dogs" =~ /dog|cat|bird/; # matches "cat"
+
+Even though C<dog> is the first alternative in the second regexp,
+C<cat> is able to match earlier in the string.
+
+ "cats" =~ /c|ca|cat|cats/; # matches "c"
+ "cats" =~ /cats|cat|ca|c/; # matches "cats"
+
+Here, all the alternatives match at the first string position, so the
+first alternative is the one that matches. If some of the
+alternatives are truncations of the others, put the longest ones first
+to give them a chance to match.
+
+ "cab" =~ /a|b|c/ # matches "c"
+ # /a|b|c/ == /[abc]/
+
+The last example points out that character classes are like
+alternations of characters. At a given character position, the first
+alternative that allows the regexp match to succeed wil be the one
+that matches.
+
+=head2 Grouping things and hierarchical matching
+
+Alternation allows a regexp to choose among alternatives, but by
+itself it unsatisfying. The reason is that each alternative is a whole
+regexp, but sometime we want alternatives for just part of a
+regexp. For instance, suppose we want to search for housecats or
+housekeepers. The regexp C<housecat|housekeeper> fits the bill, but is
+inefficient because we had to type C<house> twice. It would be nice to
+have parts of the regexp be constant, like C<house>, and and some
+parts have alternatives, like C<cat|keeper>.
+
+The B<grouping> metacharacters C<()> solve this problem. Grouping
+allows parts of a regexp to be treated as a single unit. Parts of a
+regexp are grouped by enclosing them in parentheses. Thus we could solve
+the C<housecat|housekeeper> by forming the regexp as
+C<house(cat|keeper)>. The regexp C<house(cat|keeper)> means match
+C<house> followed by either C<cat> or C<keeper>. Some more examples
+are
+
+ /(a|b)b/; # matches 'ab' or 'bb'
+ /(ac|b)b/; # matches 'acb' or 'bb'
+ /(^a|b)c/; # matches 'ac' at start of string or 'bc' anywhere
+ /(a|[bc])d/; # matches 'ad', 'bd', or 'cd'
+
+ /house(cat|)/; # matches either 'housecat' or 'house'
+ /house(cat(s|)|)/; # matches either 'housecats' or 'housecat' or
+ # 'house'. Note groups can be nested.
+
+ /(19|20|)\d\d/; # match years 19xx, 20xx, or the Y2K problem, xx
+ "20" =~ /(19|20|)\d\d/; # matches the null alternative '()\d\d',
+ # because '20\d\d' can't match
+
+Alternations behave the same way in groups as out of them: at a given
+string position, the leftmost alternative that allows the regexp to
+match is taken. So in the last example at tth first string position,
+C<"20"> matches the second alternative, but there is nothing left over
+to match the next two digits C<\d\d>. So perl moves on to the next
+alternative, which is the null alternative and that works, since
+C<"20"> is two digits.
+
+The process of trying one alternative, seeing if it matches, and
+moving on to the next alternative if it doesn't, is called
+B<backtracking>. The term 'backtracking' comes from the idea that
+matching a regexp is like a walk in the woods. Successfully matching
+a regexp is like arriving at a destination. There are many possible
+trailheads, one for each string position, and each one is tried in
+order, left to right. From each trailhead there may be many paths,
+some of which get you there, and some which are dead ends. When you
+walk along a trail and hit a dead end, you have to backtrack along the
+trail to an earlier point to try another trail. If you hit your
+destination, you stop immediately and forget about trying all the
+other trails. You are persistent, and only if you have tried all the
+trails from all the trailheads and not arrived at your destination, do
+you declare failure. To be concrete, here is a step-by-step analysis
+of what perl does when it tries to match the regexp
+
+ "abcde" =~ /(abd|abc)(df|d|de)/;
+
+=over 4
+
+=item 0 Start with the first letter in the string 'a'.
+
+=item 1 Try the first alternative in the first group 'abd'.
+
+=item 2 Match 'a' followed by 'b'. So far so good.
+
+=item 3 'd' in the regexp doesn't match 'c' in the string - a dead
+end. So backtrack two characters and pick the second alternative in
+the first group 'abc'.
+
+=item 4 Match 'a' followed by 'b' followed by 'c'. We are on a roll
+and have satisfied the first group. Set $1 to 'abc'.
+
+=item 5 Move on to the second group and pick the first alternative
+'df'.
+
+=item 6 Match the 'd'.
+
+=item 7 'f' in the regexp doesn't match 'e' in the string, so a dead
+end. Backtrack one character and pick the second alternative in the
+second group 'd'.
+
+=item 8 'd' matches. The second grouping is satisfied, so set $2 to
+'d'.
+
+=item 9 We are at the end of the regexp, so we are done! We have
+matched 'abcd' out of the string "abcde".
+
+=back
+
+There are a couple of things to note about this analysis. First, the
+third alternative in the second group 'de' also allows a match, but we
+stopped before we got to it - at a given character position, leftmost
+wins. Second, we were able to get a match at the first character
+position of the string 'a'. If there were no matches at the first
+position, perl would move to the second character position 'b' and
+attempt the match all over again. Only when all possible paths at all
+possible character positions have been exhausted does perl give give
+up and declare S<C<$string =~ /(abd|abc)(df|d|de)/;> > to be false.
+
+Even with all this work, regexp matching happens remarkably fast. To
+speed things up, during compilation stage, perl compiles the regexp
+into a compact sequence of opcodes that can often fit inside a
+processor cache. When the code is executed, these opcodes can then run
+at full throttle and search very quickly.
+
+=head2 Extracting matches
+
+The grouping metacharacters C<()> also serve another completely
+different function: they allow the extraction of the parts of a string
+that matched. This is very useful to find out what matched and for
+text processing in general. For each grouping, the part that matched
+inside goes into the special variables C<$1>, C<$2>, etc. They can be
+used just as ordinary variables:
+
+ # extract hours, minutes, seconds
+ $time =~ /(\d\d):(\d\d):(\d\d)/; # match hh:mm:ss format
+ $hours = $1;
+ $minutes = $2;
+ $seconds = $3;
+
+Now, we know that in scalar context,
+S<C<$time =~ /(\d\d):(\d\d):(\d\d)/> > returns a true or false
+value. In list context, however, it returns the list of matched values
+C<($1,$2,$3)>. So we could write the code more compactly as
+
+ # extract hours, minutes, seconds
+ ($hours, $minutes, $second) = ($time =~ /(\d\d):(\d\d):(\d\d)/);
+
+If the groupings in a regexp are nested, C<$1> gets the group with the
+leftmost opening parenthesis, C<$2> the next opening parenthesis,
+etc. For example, here is a complex regexp and the matching variables
+indicated below it:
+
+ /(ab(cd|ef)((gi)|j))/;
+ 1 2 34
+
+so that if the regexp matched, e.g., C<$2> would contain 'cd' or 'ef'.
+For convenience, perl sets C<$+> to the highest numbered C<$1>, C<$2>,
+... that got assigned.
+
+Closely associated with the matching variables C<$1>, C<$2>, ... are
+the B<backreferences> C<\1>, C<\2>, ... . Backreferences are simply
+matching variables that can be used I<inside> a regexp. This is a
+really nice feature - what matches later in a regexp can depend on
+what matched earlier in the regexp. Suppose we wanted to look
+for doubled words in text, like 'the the'. The following regexp finds
+all 3-letter doubles with a space in between:
+
+ /(\w\w\w)\s\1/;
+
+The grouping assigns a value to \1, so that the same 3 letter sequence
+is used for both parts. Here are some words with repeated parts:
+
+ % simple_grep '^(\w\w\w\w|\w\w\w|\w\w|\w)\1$' /usr/dict/words
+ beriberi
+ booboo
+ coco
+ mama
+ murmur
+ papa
+
+The regexp has a single grouping which considers 4-letter
+combinations, then 3-letter combinations, etc. and uses C<\1> to look for
+a repeat. Although C<$1> and C<\1> represent the same thing, care should be
+taken to use matched variables C<$1>, C<$2>, ... only outside a regexp
+and backreferences C<\1>, C<\2>, ... only inside a regexp; not doing
+so may lead to surprising and/or undefined results.
+
+In addition to what was matched, Perl 5.6.0 also provides the
+positions of what was matched with the C<@-> and C<@+>
+arrays. C<$-[0]> is the position of the start of the entire match and
+C<$+[0]> is the position of the end. Similarly, C<$-[n]> is the
+position of the start of the C<$n> match and C<$+[n]> is the position
+of the end. If C<$n> is undefined, so are C<$-[n]> and C<$+[n]>. Then
+this code
+
+ $x = "Mmm...donut, thought Homer";
+ $x =~ /^(Mmm|Yech)\.\.\.(donut|peas)/; # matches
+ foreach $expr (1..$#-) {
+ print "Match $expr: '${$expr}' at position ($-[$expr],$+[$expr])\n";
+ }
+
+prints
+
+ Match 1: 'Mmm' at position (0,3)
+ Match 2: 'donut' at position (6,11)
+
+Even if there are no groupings in a regexp, it is still possible to
+find out what exactly matched in a string. If you use them, perl
+will set C<$`> to the part of the string before the match, will set C<$&>
+to the part of the string that matched, and will set C<$'> to the part
+of the string after the match. An example:
+
+ $x = "the cat caught the mouse";
+ $x =~ /cat/; # $` = 'the ', $& = 'cat', $' = ' caught the mouse'
+ $x =~ /the/; # $` = '', $& = 'the', $' = ' cat caught the mouse'
+
+In the second match, S<C<$` = ''> > because the regexp matched at the
+first character position in the string and stopped, it never saw the
+second 'the'. It is important to note that using C<$`> and C<$'>
+slows down regexp matching quite a bit, and C<$&> slows it down to a
+lesser extent, because if they are used in one regexp in a program,
+they are generated for <all> regexps in the program. So if raw
+performance is a goal of your application, they should be avoided.
+If you need them, use C<@-> and C<@+> instead:
+
+ $` is the same as substr( $x, 0, $-[0] )
+ $& is the same as substr( $x, $-[0], $+[0]-$-[0] )
+ $' is the same as substr( $x, $+[0] )
+
+=head2 Matching repetitions
+
+The examples in the previous section display an annoying weakness. We
+were only matching 3-letter words, or syllables of 4 letters or
+less. We'd like to be able to match words or syllables of any length,
+without writing out tedious alternatives like
+C<\w\w\w\w|\w\w\w|\w\w|\w>.
+
+This is exactly the problem the B<quantifier> metacharacters C<?>,
+C<*>, C<+>, and C<{}> were created for. They allow us to determine the
+number of repeats of a portion of a regexp we consider to be a
+match. Quantifiers are put immediately after the character, character
+class, or grouping that we want to specify. They have the following
+meanings:
+
+=over 4
+
+=item * C<a?> = match 'a' 1 or 0 times
+
+=item * C<a*> = match 'a' 0 or more times, i.e., any number of times
+
+=item * C<a+> = match 'a' 1 or more times, i.e., at least once
+
+=item * C<a{n,m}> = match at least C<n> times, but not more than C<m>
+times.
+
+=item * C<a{n,}> = match at least C<n> or more times
+
+=item * C<a{n}> = match exactly C<n> times
+
+=back
+
+Here are some examples:
+
+ /[a-z]+\s+\d*/; # match a lowercase word, at least some space, and
+ # any number of digits
+ /(\w+)\s+\1/; # match doubled words of arbitrary length
+ /y(es)?/i; # matches 'y', 'Y', or a case-insensitive 'yes'
+ $year =~ /\d{2,4}/; # make sure year is at least 2 but not more
+ # than 4 digits
+ $year =~ /\d{4}|\d{2}/; # better match; throw out 3 digit dates
+ $year =~ /\d{2}(\d{2})?/; # same thing written differently. However,
+ # this produces $1 and the other does not.
+
+ % simple_grep '^(\w+)\1$' /usr/dict/words # isn't this easier?
+ beriberi
+ booboo
+ coco
+ mama
+ murmur
+ papa
+
+For all of these quantifiers, perl will try to match as much of the
+string as possible, while still allowing the regexp to succeed. Thus
+with C</a?.../>, perl will first try to match the regexp with the C<a>
+present; if that fails, perl will try to match the regexp without the
+C<a> present. For the quantifier C<*>, we get the following:
+
+ $x = "the cat in the hat";
+ $x =~ /^(.*)(cat)(.*)$/; # matches,
+ # $1 = 'the '
+ # $2 = 'cat'
+ # $3 = ' in the hat'
+
+Which is what we might expect, the match finds the only C<cat> in the
+string and locks onto it. Consider, however, this regexp:
+
+ $x =~ /^(.*)(at)(.*)$/; # matches,
+ # $1 = 'the cat in the h'
+ # $2 = 'at'
+ # $3 = '' (0 matches)
+
+One might initially guess that perl would find the C<at> in C<cat> and
+stop there, but that wouldn't give the longest possible string to the
+first quantifier C<.*>. Instead, the first quantifier C<.*> grabs as
+much of the string as possible while still having the regexp match. In
+this example, that means having the C<at> sequence with the final <at>
+in the string. The other important principle illustrated here is that
+when there are two or more elements in a regexp, the I<leftmost>
+quantifier, if there is one, gets to grab as much the string as
+possible, leaving the rest of the regexp to fight over scraps. Thus in
+our example, the first quantifier C<.*> grabs most of the string, while
+the second quantifier C<.*> gets the empty string. Quantifiers that
+grab as much of the string as possible are called B<maximal match> or
+B<greedy> quantifiers.
+
+When a regexp can match a string in several different ways, we can use
+the principles above to predict which way the regexp will match:
+
+=over 4
+
+=item *
+Principle 0: Taken as a whole, any regexp will be matched at the
+earliest possible position in the string.
+
+=item *
+Principle 1: In an alternation C<a|b|c...>, the leftmost alternative
+that allows a match for the whole regexp will be the one used.
+
+=item *
+Principle 2: The maximal matching quantifiers C<?>, C<*>, C<+> and
+C<{n,m}> will in general match as much of the string as possible while
+still allowing the whole regexp to match.
+
+=item *
+Principle 3: If there are two or more elements in a regexp, the
+leftmost greedy quantifier, if any, will match as much of the string
+as possible while still allowing the whole regexp to match. The next
+leftmost greedy quantifier, if any, will try to match as much of the
+string remaining available to it as possible, while still allowing the
+whole regexp to match. And so on, until all the regexp elements are
+satisfied.
+
+=back
+
+As we have seen above, Principle 0 overrides the others - the regexp
+will be matched as early as possible, with the other principles
+determining how the regexp matches at that earliest character
+position.
+
+Here is an example of these principles in action:
+
+ $x = "The programming republic of Perl";
+ $x =~ /^(.+)(e|r)(.*)$/; # matches,
+ # $1 = 'The programming republic of Pe'
+ # $2 = 'r'
+ # $3 = 'l'
+
+This regexp matches at the earliest string position, C<'T'>. One
+might think that C<e>, being leftmost in the alternation, would be
+matched, but C<r> produces the longest string in the first quantifier.
+
+ $x =~ /(m{1,2})(.*)$/; # matches,
+ # $1 = 'mm'
+ # $2 = 'ing republic of Perl'
+
+Here, The earliest possible match is at the first C<'m'> in
+C<programming>. C<m{1,2}> is the first quantifier, so it gets to match
+a maximal C<mm>.
+
+ $x =~ /.*(m{1,2})(.*)$/; # matches,
+ # $1 = 'm'
+ # $2 = 'ing republic of Perl'
+
+Here, the regexp matches at the start of the string. The first
+quantifier C<.*> grabs as much as possible, leaving just a single
+C<'m'> for the second quantifier C<m{1,2}>.
+
+ $x =~ /(.?)(m{1,2})(.*)$/; # matches,
+ # $1 = 'a'
+ # $2 = 'mm'
+ # $3 = 'ing republic of Perl'
+
+Here, C<.?> eats its maximal one character at the earliest possible
+position in the string, C<'a'> in C<programming>, leaving C<m{1,2}>
+the opportunity to match both C<m>'s. Finally,
+
+ "aXXXb" =~ /(X*)/; # matches with $1 = ''
+
+because it can match zero copies of C<'X'> at the beginning of the
+string. If you definitely want to match at least one C<'X'>, use
+C<X+>, not C<X*>.
+
+Sometimes greed is not good. At times, we would like quantifiers to
+match a I<minimal> piece of string, rather than a maximal piece. For
+this purpose, Larry Wall created the S<B<minimal match> > or
+B<non-greedy> quantifiers C<??>,C<*?>, C<+?>, and C<{}?>. These are
+the usual quantifiers with a C<?> appended to them. They have the
+following meanings:
+
+=over 4
+
+=item * C<a??> = match 'a' 0 or 1 times. Try 0 first, then 1.
+
+=item * C<a*?> = match 'a' 0 or more times, i.e., any number of times,
+but as few times as possible
+
+=item * C<a+?> = match 'a' 1 or more times, i.e., at least once, but
+as few times as possible
+
+=item * C<a{n,m}?> = match at least C<n> times, not more than C<m>
+times, as few times as possible
+
+=item * C<a{n,}?> = match at least C<n> times, but as few times as
+possible
+
+=item * C<a{n}?> = match exactly C<n> times. Because we match exactly
+C<n> times, C<a{n}?> is equivalent to C<a{n}> and is just there for
+notational consistency.
+
+=back
+
+Let's look at the example above, but with minimal quantifiers:
+
+ $x = "The programming republic of Perl";
+ $x =~ /^(.+?)(e|r)(.*)$/; # matches,
+ # $1 = 'Th'
+ # $2 = 'e'
+ # $3 = ' programming republic of Perl'
+
+The minimal string that will allow both the start of the string C<^>
+and the alternation to match is C<Th>, with the alternation C<e|r>
+matching C<e>. The second quantifier C<.*> is free to gobble up the
+rest of the string.
+
+ $x =~ /(m{1,2}?)(.*?)$/; # matches,
+ # $1 = 'm'
+ # $2 = 'ming republic of Perl'
+
+The first string position that this regexp can match is at the first
+C<'m'> in C<programming>. At this position, the minimal C<m{1,2}?>
+matches just one C<'m'>. Although the second quantifier C<.*?> would
+prefer to match no characters, it is constrained by the end-of-string
+anchor C<$> to match the rest of the string.
+
+ $x =~ /(.*?)(m{1,2}?)(.*)$/; # matches,
+ # $1 = 'The progra'
+ # $2 = 'm'
+ # $3 = 'ming republic of Perl'
+
+In this regexp, you might expect the first minimal quantifier C<.*?>
+to match the empty string, because it is not constrained by a C<^>
+anchor to match the beginning of the word. Principle 0 applies here,
+however. Because it is possible for the whole regexp to match at the
+start of the string, it I<will> match at the start of the string. Thus
+the first quantifier has to match everything up to the first C<m>. The
+second minimal quantifier matches just one C<m> and the third
+quantifier matches the rest of the string.
+
+ $x =~ /(.??)(m{1,2})(.*)$/; # matches,
+ # $1 = 'a'
+ # $2 = 'mm'
+ # $3 = 'ing republic of Perl'
+
+Just as in the previous regexp, the first quantifier C<.??> can match
+earliest at position C<'a'>, so it does. The second quantifier is
+greedy, so it matches C<mm>, and the third matches the rest of the
+string.
+
+We can modify principle 3 above to take into account non-greedy
+quantifiers:
+
+=over 4
+
+=item *
+Principle 3: If there are two or more elements in a regexp, the
+leftmost greedy (non-greedy) quantifier, if any, will match as much
+(little) of the string as possible while still allowing the whole
+regexp to match. The next leftmost greedy (non-greedy) quantifier, if
+any, will try to match as much (little) of the string remaining
+available to it as possible, while still allowing the whole regexp to
+match. And so on, until all the regexp elements are satisfied.
+
+=back
+
+Just like alternation, quantifiers are also susceptible to
+backtracking. Here is a step-by-step analysis of the example
+
+ $x = "the cat in the hat";
+ $x =~ /^(.*)(at)(.*)$/; # matches,
+ # $1 = 'the cat in the h'
+ # $2 = 'at'
+ # $3 = '' (0 matches)
+
+=over 4
+
+=item 0 Start with the first letter in the string 't'.
+
+=item 1 The first quantifier '.*' starts out by matching the whole
+string 'the cat in the hat'.
+
+=item 2 'a' in the regexp element 'at' doesn't match the end of the
+string. Backtrack one character.
+
+=item 3 'a' in the regexp element 'at' still doesn't match the last
+letter of the string 't', so backtrack one more character.
+
+=item 4 Now we can match the 'a' and the 't'.
+
+=item 5 Move on to the third element '.*'. Since we are at the end of
+the string and '.*' can match 0 times, assign it the empty string.
+
+=item 6 We are done!
+
+=back
+
+Most of the time, all this moving forward and backtracking happens
+quickly and searching is fast. There are some pathological regexps,
+however, whose execution time exponentially grows with the size of the
+string. A typical structure that blows up in your face is of the form
+
+ /(a|b+)*/;
+
+The problem is the nested indeterminate quantifiers. There are many
+different ways of partitioning a string of length n between the C<+>
+and C<*>: one repetition with C<b+> of length n, two repetitions with
+the first C<b+> length k and the second with length n-k, m repetitions
+whose bits add up to length n, etc. In fact there are an exponential
+number of ways to partition a string as a function of length. A
+regexp may get lucky and match early in the process, but if there is
+no match, perl will try I<every> possibility before giving up. So be
+careful with nested C<*>'s, C<{n,m}>'s, and C<+>'s. The book
+I<Mastering regular expressions> by Jeffrey Friedl gives a wonderful
+discussion of this and other efficiency issues.
+
+=head2 Building a regexp
+
+At this point, we have all the basic regexp concepts covered, so let's
+give a more involved example of a regular expression. We will build a
+regexp that matches numbers.
+
+The first task in building a regexp is to decide what we want to match
+and what we want to exclude. In our case, we want to match both
+integers and floating point numbers and we want to reject any string
+that isn't a number.
+
+The next task is to break the problem down into smaller problems that
+are easily converted into a regexp.
+
+The simplest case is integers. These consist of a sequence of digits,
+with an optional sign in front. The digits we can represent with
+C<\d+> and the sign can be matched with C<[+-]>. Thus the integer
+regexp is
+
+ /[+-]?\d+/; # matches integers
+
+A floating point number potentially has a sign, an integral part, a
+decimal point, a fractional part, and an exponent. One or more of these
+parts is optional, so we need to check out the different
+possibilities. Floating point numbers which are in proper form include
+123., 0.345, .34, -1e6, and 25.4E-72. As with integers, the sign out
+front is completely optional and can be matched by C<[+-]?>. We can
+see that if there is no exponent, floating point numbers must have a
+decimal point, otherwise they are integers. We might be tempted to
+model these with C<\d*\.\d*>, but this would also match just a single
+decimal point, which is not a number. So the three cases of floating
+point number sans exponent are
+
+ /[+-]?\d+\./; # 1., 321., etc.
+ /[+-]?\.\d+/; # .1, .234, etc.
+ /[+-]?\d+\.\d+/; # 1.0, 30.56, etc.
+
+These can be combined into a single regexp with a three-way alternation:
+
+ /[+-]?(\d+\.\d+|\d+\.|\.\d+)/; # floating point, no exponent
+
+In this alternation, it is important to put C<'\d+\.\d+'> before
+C<'\d+\.'>. If C<'\d+\.'> were first, the regexp would happily match that
+and ignore the fractional part of the number.
+
+Now consider floating point numbers with exponents. The key
+observation here is that I<both> integers and numbers with decimal
+points are allowed in front of an exponent. Then exponents, like the
+overall sign, are independent of whether we are matching numbers with
+or without decimal points, and can be 'decoupled' from the
+mantissa. The overall form of the regexp now becomes clear:
+
+ /^(optional sign)(integer | f.p. mantissa)(optional exponent)$/;
+
+The exponent is an C<e> or C<E>, followed by an integer. So the
+exponent regexp is
+
+ /[eE][+-]?\d+/; # exponent
+
+Putting all the parts together, we get a regexp that matches numbers:
+
+ /^[+-]?(\d+\.\d+|\d+\.|\.\d+|\d+)([eE][+-]?\d+)?$/; # Ta da!
+
+Long regexps like this may impress your friends, but can be hard to
+decipher. In complex situations like this, the C<//x> modifier for a
+match is invaluable. It allows one to put nearly arbitrary whitespace
+and comments into a regexp without affecting their meaning. Using it,
+we can rewrite our 'extended' regexp in the more pleasing form
+
+ /^
+ [+-]? # first, match an optional sign
+ ( # then match integers or f.p. mantissas:
+ \d+\.\d+ # mantissa of the form a.b
+ |\d+\. # mantissa of the form a.
+ |\.\d+ # mantissa of the form .b
+ |\d+ # integer of the form a
+ )
+ ([eE][+-]?\d+)? # finally, optionally match an exponent
+ $/x;
+
+If whitespace is mostly irrelevant, how does one include space
+characters in an extended regexp? The answer is to backslash it
+S<C<'\ '> > or put it in a character class S<C<[ ]> >. The same thing
+goes for pound signs, use C<\#> or C<[#]>. For instance, Perl allows
+a space between the sign and the mantissa/integer, and we could add
+this to our regexp as follows:
+
+ /^
+ [+-]?\ * # first, match an optional sign *and space*
+ ( # then match integers or f.p. mantissas:
+ \d+\.\d+ # mantissa of the form a.b
+ |\d+\. # mantissa of the form a.
+ |\.\d+ # mantissa of the form .b
+ |\d+ # integer of the form a
+ )
+ ([eE][+-]?\d+)? # finally, optionally match an exponent
+ $/x;
+
+In this form, it is easier to see a way to simplify the
+alternation. Alternatives 1, 2, and 4 all start with C<\d+>, so it
+could be factored out:
+
+ /^
+ [+-]?\ * # first, match an optional sign
+ ( # then match integers or f.p. mantissas:
+ \d+ # start out with a ...
+ (
+ \.\d* # mantissa of the form a.b or a.
+ )? # ? takes care of integers of the form a
+ |\.\d+ # mantissa of the form .b
+ )
+ ([eE][+-]?\d+)? # finally, optionally match an exponent
+ $/x;
+
+or written in the compact form,
+
+ /^[+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?$/;
+
+This is our final regexp. To recap, we built a regexp by
+
+=over 4
+
+=item * specifying the task in detail,
+
+=item * breaking down the problem into smaller parts,
+
+=item * translating the small parts into regexps,
+
+=item * combining the regexps,
+
+=item * and optimizing the final combined regexp.
+
+=back
+
+These are also the typical steps involved in writing a computer
+program. This makes perfect sense, because regular expressions are
+essentially programs written a little computer language that specifies
+patterns.
+
+=head2 Using regular expressions in Perl
+
+The last topic of Part 1 briefly covers how regexps are used in Perl
+programs. Where do they fit into Perl syntax?
+
+We have already introduced the matching operator in its default
+C</regexp/> and arbitrary delimiter C<m!regexp!> forms. We have used
+the binding operator C<=~> and its negation C<!~> to test for string
+matches. Associated with the matching operator, we have discussed the
+single line C<//s>, multi-line C<//m>, case-insensitive C<//i> and
+extended C<//x> modifiers.
+
+There are a few more things you might want to know about matching
+operators. First, we pointed out earlier that variables in regexps are
+substituted before the regexp is evaluated:
+
+ $pattern = 'Seuss';
+ while (<>) {
+ print if /$pattern/;
+ }
+
+This will print any lines containing the word C<Seuss>. It is not as
+efficient as it could be, however, because perl has to re-evaluate
+C<$pattern> each time through the loop. If C<$pattern> won't be
+changing over the lifetime of the script, we can add the C<//o>
+modifier, which directs perl to only perform variable substitutions
+once:
+
+ #!/usr/bin/perl
+ # Improved simple_grep
+ $regexp = shift;
+ while (<>) {
+ print if /$regexp/o; # a good deal faster
+ }
+
+If you change C<$pattern> after the first substitution happens, perl
+will ignore it. If you don't want any substitutions at all, use the
+special delimiter C<m''>:
+
+ $pattern = 'Seuss';
+ while (<>) {
+ print if m'$pattern'; # matches '$pattern', not 'Seuss'
+ }
+
+C<m''> acts like single quotes on a regexp; all other C<m> delimiters
+act like double quotes. If the regexp evaluates to the empty string,
+the regexp in the I<last successful match> is used instead. So we have
+
+ "dog" =~ /d/; # 'd' matches
+ "dogbert =~ //; # this matches the 'd' regexp used before
+
+The final two modifiers C<//g> and C<//c> concern multiple matches.
+The modifier C<//g> stands for global matching and allows the the
+matching operator to match within a string as many times as possible.
+In scalar context, successive invocations against a string will have
+`C<//g> jump from match to match, keeping track of position in the
+string as it goes along. You can get or set the position with the
+C<pos()> function.
+
+The use of C<//g> is shown in the following example. Suppose we have
+a string that consists of words separated by spaces. If we know how
+many words there are in advance, we could extract the words using
+groupings:
+
+ $x = "cat dog house"; # 3 words
+ $x =~ /^\s*(\w+)\s+(\w+)\s+(\w+)\s*$/; # matches,
+ # $1 = 'cat'
+ # $2 = 'dog'
+ # $3 = 'house'
+
+But what if we had an indeterminate number of words? This is the sort
+of task C<//g> was made for. To extract all words, form the simple
+regexp C<(\w+)> and loop over all matches with C</(\w+)/g>:
+
+ while ($x =~ /(\w+)/g) {
+ print "Word is $1, ends at position ", pos $x, "\n";
+ }
+
+prints
+
+ Word is cat, ends at position 3
+ Word is dog, ends at position 7
+ Word is house, ends at position 13
+
+A failed match or changing the target string resets the position. If
+you don't want the position reset after failure to match, add the
+C<//c>, as in C</regexp/gc>. The current position in the string is
+associated with the string, not the regexp. This means that different
+strings have different positions and their respective positions can be
+set or read independently.
+
+In list context, C<//g> returns a list of matched groupings, or if
+there are no groupings, a list of matches to the whole regexp. So if
+we wanted just the words, we could use
+
+ @words = ($x =~ /(\w+)/g); # matches,
+ # $word[0] = 'cat'
+ # $word[1] = 'dog'
+ # $word[2] = 'house'
+
+Closely associated with the C<//g> modifier is the C<\G> anchor. The
+C<\G> anchor matches at the point where the previous C<//g> match left
+off. C<\G> allows us to easily do context-sensitive matching:
+
+ $metric = 1; # use metric units
+ ...
+ $x = <FILE>; # read in measurement
+ $x =~ /^([+-]?\d+)\s*/g; # get magnitude
+ $weight = $1;
+ if ($metric) { # error checking
+ print "Units error!" unless $x =~ /\Gkg\./g;
+ }
+ else {
+ print "Units error!" unless $x =~ /\Glbs\./g;
+ }
+ $x =~ /\G\s+(widget|sprocket)/g; # continue processing
+
+The combination of C<//g> and C<\G> allows us to process the string a
+bit at a time and use arbitrary Perl logic to decide what to do next.
+
+C<\G> is also invaluable in processing fixed length records with
+regexps. Suppose we have a snippet of coding region DNA, encoded as
+base pair letters C<ATCGTTGAAT...> and we want to find all the stop
+codons C<TGA>. In a coding region, codons are 3-letter sequences, so
+we can think of the DNA snippet as a sequence of 3-letter records. The
+naive regexp
+
+ # expanded, this is "ATC GTT GAA TGC AAA TGA CAT GAC"
+ $dna = "ATCGTTGAATGCAAATGACATGAC";
+ $dna =~ /TGA/;
+
+doesn't work; it may match an C<TGA>, but there is no guarantee that
+the match is aligned with codon boundaries, e.g., the substring
+S<C<GTT GAA> > gives a match. A better solution is
+
+ while ($dna =~ /(\w\w\w)*?TGA/g) { # note the minimal *?
+ print "Got a TGA stop codon at position ", pos $dna, "\n";
+ }
+
+which prints
+
+ Got a TGA stop codon at position 18
+ Got a TGA stop codon at position 23
+
+Position 18 is good, but position 23 is bogus. What happened?
+
+The answer is that our regexp works well until we get past the last
+real match. Then the regexp will fail to match a synchronized C<TGA>
+and start stepping ahead one character position at a time, not what we
+want. The solution is to use C<\G> to anchor the match to the codon
+alignment:
+
+ while ($dna =~ /\G(\w\w\w)*?TGA/g) {
+ print "Got a TGA stop codon at position ", pos $dna, "\n";
+ }
+
+This prints
+
+ Got a TGA stop codon at position 18
+
+which is the correct answer. This example illustrates that it is
+important not only to match what is desired, but to reject what is not
+desired.
+
+B<search and replace>
+
+Regular expressions also play a big role in B<search and replace>
+operations in Perl. Search and replace is accomplished with the
+C<s///> operator. The general form is
+C<s/regexp/replacement/modifiers>, with everything we know about
+regexps and modifiers applying in this case as well. The
+C<replacement> is a Perl double quoted string that replaces in the
+string whatever is matched with the C<regexp>. The operator C<=~> is
+also used here to associate a string with C<s///>. If matching
+against C<$_>, the S<C<$_ =~> > can be dropped. If there is a match,
+C<s///> returns the number of substitutions made, otherwise it returns
+false. Here are a few examples:
+
+ $x = "Time to feed the cat!";
+ $x =~ s/cat/hacker/; # $x contains "Time to feed the hacker!"
+ if ($x =~ s/^(Time.*hacker)!$/$1 now!/) {
+ $more_insistent = 1;
+ }
+ $y = "'quoted words'";
+ $y =~ s/^'(.*)'$/$1/; # strip single quotes,
+ # $y contains "quoted words"
+
+In the last example, the whole string was matched, but only the part
+inside the single quotes was grouped. With the C<s///> operator, the
+matched variables C<$1>, C<$2>, etc. are immediately available for use
+in the replacement expression, so we use C<$1> to replace the quoted
+string with just what was quoted. With the global modifier, C<s///g>
+will search and replace all occurrences of the regexp in the string:
+
+ $x = "I batted 4 for 4";
+ $x =~ s/4/four/; # doesn't do it all:
+ # $x contains "I batted four for 4"
+ $x = "I batted 4 for 4";
+ $x =~ s/4/four/g; # does it all:
+ # $x contains "I batted four for four"
+
+If you prefer 'regex' over 'regexp' in this tutorial, you could use
+the following program to replace it:
+
+ % cat > simple_replace
+ #!/usr/bin/perl
+ $regexp = shift;
+ $replacement = shift;
+ while (<>) {
+ s/$regexp/$replacement/go;
+ print;
+ }
+ ^D
+
+ % simple_replace regexp regex perlretut.pod
+
+In C<simple_replace> we used the C<s///g> modifier to replace all
+occurrences of the regexp on each line and the C<s///o> modifier to
+compile the regexp only once. As with C<simple_grep>, both the
+C<print> and the C<s/$regexp/$replacement/go> use C<$_> implicitly.
+
+A modifier available specifically to search and replace is the
+C<s///e> evaluation modifier. C<s///e> wraps an C<eval{...}> around
+the replacement string and the evaluated result is substituted for the
+matched substring. C<s///e> is useful if you need to do a bit of
+computation in the process of replacing text. This example counts
+character frequencies in a line:
+
+ $x = "Bill the cat";
+ $x =~ s/(.)/$chars{$1}++;$1/eg; # final $1 replaces char with itself
+ print "frequency of '$_' is $chars{$_}\n"
+ foreach (sort {$chars{$b} <=> $chars{$a}} keys %chars);
+
+This prints
+
+ frequency of ' ' is 2
+ frequency of 't' is 2
+ frequency of 'l' is 2
+ frequency of 'B' is 1
+ frequency of 'c' is 1
+ frequency of 'e' is 1
+ frequency of 'h' is 1
+ frequency of 'i' is 1
+ frequency of 'a' is 1
+
+As with the match C<m//> operator, C<s///> can use other delimiters,
+such as C<s!!!> and C<s{}{}>, and even C<s{}//>. If single quotes are
+used C<s'''>, then the regexp and replacement are treated as single
+quoted strings and there are no substitutions. C<s///> in list context
+returns the same thing as in scalar context, i.e., the number of
+matches.
+
+B<The split operator>
+
+The B<C<split> > function can also optionally use a matching operator
+C<m//> to split a string. C<split /regexp/, string, limit> splits
+C<string> into a list of substrings and returns that list. The regexp
+is used to match the character sequence that the C<string> is split
+with respect to. The C<limit>, if present, constrains splitting into
+no more than C<limit> number of strings. For example, to split a
+string into words, use
+
+ $x = "Calvin and Hobbes";
+ @words = split /\s+/, $x; # $word[0] = 'Calvin'
+ # $word[1] = 'and'
+ # $word[2] = 'Hobbes'
+
+If the empty regexp C<//> is used, the regexp always matches and
+the string is split into individual characters. If the regexp has
+groupings, then list produced contains the matched substrings from the
+groupings as well. For instance,
+
+ $x = "/usr/bin/perl";
+ @dirs = split m!/!, $x; # $dirs[0] = ''
+ # $dirs[1] = 'usr'
+ # $dirs[2] = 'bin'
+ # $dirs[3] = 'perl'
+ @parts = split m!(/)!, $x; # $parts[0] = ''
+ # $parts[1] = '/'
+ # $parts[2] = 'usr'
+ # $parts[3] = '/'
+ # $parts[4] = 'bin'
+ # $parts[5] = '/'
+ # $parts[6] = 'perl'
+
+Since the first character of $x matched the regexp, C<split> prepended
+an empty initial element to the list.
+
+If you have read this far, congratulations! You now have all the basic
+tools needed to use regular expressions to solve a wide range of text
+processing problems. If this is your first time through the tutorial,
+why not stop here and play around with regexps a while... S<Part 2>
+concerns the more esoteric aspects of regular expressions and those
+concepts certainly aren't needed right at the start.
+
+=head1 Part 2: Power tools
+
+OK, you know the basics of regexps and you want to know more. If
+matching regular expressions is analogous to a walk in the woods, then
+the tools discussed in Part 1 are analogous to topo maps and a
+compass, basic tools we use all the time. Most of the tools in part 2
+are are analogous to flare guns and satellite phones. They aren't used
+too often on a hike, but when we are stuck, they can be invaluable.
+
+What follows are the more advanced, less used, or sometimes esoteric
+capabilities of perl regexps. In Part 2, we will assume you are
+comfortable with the basics and concentrate on the new features.
+
+=head2 More on characters, strings, and character classes
+
+There are a number of escape sequences and character classes that we
+haven't covered yet.
+
+There are several escape sequences that convert characters or strings
+between upper and lower case. C<\l> and C<\u> convert the next
+character to lower or upper case, respectively:
+
+ $x = "perl";
+ $string =~ /\u$x/; # matches 'Perl' in $string
+ $x = "M(rs?|s)\\."; # note the double backslash
+ $string =~ /\l$x/; # matches 'mr.', 'mrs.', and 'ms.',
+
+C<\L> and C<\U> converts a whole substring, delimited by C<\L> or
+C<\U> and C<\E>, to lower or upper case:
+
+ $x = "This word is in lower case:\L SHOUT\E";
+ $x =~ /shout/; # matches
+ $x = "I STILL KEYPUNCH CARDS FOR MY 360"
+ $x =~ /\Ukeypunch/; # matches punch card string
+
+If there is no C<\E>, case is converted until the end of the
+string. The regexps C<\L\u$word> or C<\u\L$word> convert the first
+character of C<$word> to uppercase and the rest of the characters to
+lowercase.
+
+Control characters can be escaped with C<\c>, so that a control-Z
+character would be matched with C<\cZ>. The escape sequence
+C<\Q>...C<\E> quotes, or protects most non-alphabetic characters. For
+instance,
+
+ $x = "\QThat !^*&%~& cat!";
+ $x =~ /\Q!^*&%~&\E/; # check for rough language
+
+It does not protect C<$> or C<@>, so that variables can still be
+substituted.
+
+With the advent of 5.6.0, perl regexps can handle more than just the
+standard ASCII character set. Perl now supports B<Unicode>, a standard
+for encoding the character sets from many of the world's written
+languages. Unicode does this by allowing characters to be more than
+one byte wide. Perl uses the UTF-8 encoding, in which ASCII characters
+are still encoded as one byte, but characters greater than C<chr(127)>
+may be stored as two or more bytes.
+
+What does this mean for regexps? Well, regexp users don't need to know
+much about perl's internal representation of strings. But they do need
+to know 1) how to represent Unicode characters in a regexp and 2) when
+a matching operation will treat the string to be searched as a
+sequence of bytes (the old way) or as a sequence of Unicode characters
+(the new way). The answer to 1) is that Unicode characters greater
+than C<chr(127)> may be represented using the C<\x{hex}> notation,
+with C<hex> a hexadecimal integer:
+
+ use utf8; # We will be doing Unicode processing
+ /\x{263a}/; # match a Unicode smiley face :)
+
+Unicode characters in the range of 128-255 use two hexadecimal digits
+with braces: C<\x{ab}>. Note that this is different than C<\xab>,
+which is just a hexadecimal byte with no Unicode
+significance.
+
+Figuring out the hexadecimal sequence of a Unicode character you want
+or deciphering someone else's hexadecimal Unicode regexp is about as
+much fun as programming in machine code. So another way to specify
+Unicode characters is to use the S<B<named character> > escape
+sequence C<\N{name}>. C<name> is a name for the Unicode character, as
+specified in the Unicode standard. For instance, if we wanted to
+represent or match the astrological sign for the planet Mercury, we
+could use
+
+ use utf8; # We will be doing Unicode processing
+ use charnames ":full"; # use named chars with Unicode full names
+ $x = "abc\N{MERCURY}def";
+ $x =~ /\N{MERCURY}/; # matches
+
+One can also use short names or restrict names to a certain alphabet:
+
+ use utf8; # We will be doing Unicode processing
+
+ use charnames ':full';
+ print "\N{GREEK SMALL LETTER SIGMA} is called sigma.\n";
+
+ use charnames ":short";
+ print "\N{greek:Sigma} is an upper-case sigma.\n";
+
+ use charnames qw(greek);
+ print "\N{sigma} is Greek sigma\n";
+
+A list of full names is found in the file Names.txt in the
+lib/perl5/5.6.0/unicode directory.
+
+The answer to requirement 2), as of 5.6.0, is that if a regexp
+contains Unicode characters, the string is searched as a sequence of
+Unicode characters. Otherwise, the string is searched as a sequence of
+bytes. If the string is being searched as a sequence of Unicode
+characters, but matching a single byte is required, we can use the C<\C>
+escape sequence. C<\C> is a character class akin to C<.> except that
+it matches I<any> byte 0-255. So
+
+ use utf8; # We will be doing Unicode processing
+ use charnames ":full"; # use named chars with Unicode full names
+ $x = "a";
+ $x =~ /\C/; # matches 'a', eats one byte
+ $x = "";
+ $x =~ /\C/; # doesn't match, no bytes to match
+ $x = "\N{MERCURY}"; # two-byte Unicode character
+ $x =~ /\C/; # matches, but dangerous!
+
+The last regexp matches, but is dangerous because the string
+I<character> position is no longer synchronized to the string <byte>
+position. This generates the warning 'Malformed UTF-8
+character'. C<\C> is best used for matching the binary data in strings
+with binary data intermixed with Unicode characters.
+
+Let us now discuss the rest of the character classes. Just as with
+Unicode characters, there are named Unicode character classes
+represented by the C<\p{name}> escape sequence. Closely associated is
+the C<\P{name}> character class, which is the negation of the
+C<\p{name}> class. For example, to match lower and uppercase
+characters,
+
+ use utf8; # We will be doing Unicode processing
+ use charnames ":full"; # use named chars with Unicode full names
+ $x = "BOB";
+ $x =~ /^\p{IsUpper}/; # matches, uppercase char class
+ $x =~ /^\P{IsUpper}/; # doesn't match, char class sans uppercase
+ $x =~ /^\p{IsLower}/; # doesn't match, lowercase char class
+ $x =~ /^\P{IsLower}/; # matches, char class sans lowercase
+
+If a C<name> is just one letter, the braces can be dropped. For
+instance, C<\pM> is the character class of Unicode 'marks'. Here is
+the association between some Perl named classes and the traditional
+Unicode classes:
+
+ Perl class name Unicode class name
+
+ IsAlpha Lu, Ll, or Lo
+ IsAlnum Lu, Ll, Lo, or Nd
+ IsASCII $code le 127
+ IsCntrl C
+ IsDigit Nd
+ IsGraph [^C] and $code ne "0020"
+ IsLower Ll
+ IsPrint [^C]
+ IsPunct P
+ IsSpace Z, or ($code lt "0020" and chr(hex $code) is a \s)
+ IsUpper Lu
+ IsWord Lu, Ll, Lo, Nd or $code eq "005F"
+ IsXDigit $code =~ /^00(3[0-9]|[46][1-6])$/
+
+For a full list of Perl class names, consult the mktables.PL program
+in the lib/perl5/5.6.0/unicode directory.
+
+C<\X> is an abbreviation for a character class sequence that includes
+the Unicode 'combining character sequences'. A 'combining character
+sequence' is a base character followed by any number of combining
+characters. An example of a combining character is an accent. Using
+the Unicode full names, e.g., S<C<A + COMBINING RING> > is a combining
+character sequence with base character C<A> and combining character
+S<C<COMBINING RING> >, which translates in Danish to A with the circle
+atop it, as in the word Angstrom. C<\X> is equivalent to C<\PM\pM*}>,
+i.e., a non-mark followed by one or more marks.
+
+As if all those classes weren't enough, Perl also defines POSIX style
+character classes. These have the form C<[:name:]>, with C<name> the
+name of the POSIX class. The POSIX classes are alpha, alnum, ascii,
+cntrl, digit, graph, lower, print, punct, space, upper, word, and
+xdigit. If C<utf8> is being used, then these classes are defined the
+same as their corresponding perl Unicode classes: C<[:upper:]> is the
+same as C<\p{IsUpper}>, etc. The POSIX character classes, however,
+don't require using C<utf8>. The C<[:digit:]>, C<[:word:]>, and
+C<[:space:]> correspond to the familiar C<\d>, C<\w>, and C<\s>
+character classes. To negate a POSIX class, put a C<^> in front of the
+name, so that, e.g., C<[:^digit:]> corresponds to C<\D> and under
+C<utf8>, C<\P{IsDigit}>. The Unicode and POSIX character classes can
+be used just like C<\d>, both inside and outside of character classes:
+
+ /\s+[abc[:digit:]xyz]\s*/; # match a,b,c,x,y,z, or a digit
+ /^=item\s[:digit:]/; # match '=item',
+ # followed by a space and a digit
+ use utf8;
+ use charnames ":full";
+ /\s+[abc\p{IsDigit}xyz]\s+/; # match a,b,c,x,y,z, or a digit
+ /^=item\s\p{IsDigit}/; # match '=item',
+ # followed by a space and a digit
+
+Whew! That is all the rest of the characters and character classes.
+
+=head2 Compiling and saving regular expressions
+
+In Part 1 we discussed the C<//o> modifier, which compiles a regexp
+just once. This suggests that a compiled regexp is some data structure
+that can be stored once and used again and again. The regexp quote
+C<qr//> does exactly that: C<qr/string/> compiles the C<string> as a
+regexp and transforms the result into a form that can be assigned to a
+variable:
+
+ $reg = qr/foo+bar?/; # reg contains a compiled regexp
+
+Then C<$reg> can be used as a regexp:
+
+ $x = "fooooba";
+ $x =~ $reg; # matches, just like /foo+bar?/
+ $x =~ /$reg/; # same thing, alternate form
+
+C<$reg> can also be interpolated into a larger regexp:
+
+ $x =~ /(abc)?$reg/; # still matches
+
+As with the matching operator, the regexp quote can use different
+delimiters, e.g., C<qr!!>, C<qr{}> and C<qr~~>. The single quote
+delimiters C<qr''> prevent any interpolation from taking place.
+
+Pre-compiled regexps are useful for creating dynamic matches that
+don't need to be recompiled each time they are encountered. Using
+pre-compiled regexps, C<simple_grep> program can be expanded into a
+program that matches multiple patterns:
+
+ % cat > multi_grep
+ #!/usr/bin/perl
+ # multi_grep - match any of <number> regexps
+ # usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ...
+
+ $number = shift;
+ $regexp[$_] = shift foreach (0..$number-1);
+ @compiled = map qr/$_/, @regexp;
+ while ($line = <>) {
+ foreach $pattern (@compiled) {
+ if ($line =~ /$pattern/) {
+ print $line;
+ last; # we matched, so move onto the next line
+ }
+ }
+ }
+ ^D
+
+ % multi_grep 2 last for multi_grep
+ $regexp[$_] = shift foreach (0..$number-1);
+ foreach $pattern (@compiled) {
+ last;
+
+Storing pre-compiled regexps in an array C<@compiled> allows us to
+simply loop through the regexps without any recompilation, thus gaining
+flexibility without sacrificing speed.
+
+=head2 Embedding comments and modifiers in a regular expression
+
+Starting with this section, we will be discussing Perl's set of
+B<extended patterns>. These are extensions to the traditional regular
+expression syntax that provide powerful new tools for pattern
+matching. We have already seen extensions in the form of the minimal
+matching constructs C<??>, C<*?>, C<+?>, C<{n,m}?>, and C<{n,}?>. The
+rest of the extensions below have the form C<(?char...)>, where the
+C<char> is a character that determines the type of extension.
+
+The first extension is an embedded comment C<(?#text)>. This embeds a
+comment into the regular expression without affecting its meaning. The
+comment should not have any closing parentheses in the text. An
+example is
+
+ /(?# Match an integer:)[+-]?\d+/;
+
+This style of commenting has been largely superseded by the raw,
+freeform commenting that is allowed with the C<//x> modifier.
+
+The modifiers C<//i>, C<//m>, C<//s>, and C<//x> can also embedded in
+a regexp using C<(?i)>, C<(?m)>, C<(?s)>, and C<(?x)>. For instance,
+
+ /(?i)yes/; # match 'yes' case insensitively
+ /yes/i; # same thing
+ /(?x)( # freeform version of an integer regexp
+ [+-]? # match an optional sign
+ \d+ # match a sequence of digits
+ )
+ /x;
+
+Embedded modifiers can have two important advantages over the usual
+modifiers. Embedded modifiers allow a custom set of modifiers to
+I<each> regexp pattern. This is great for matching an array of regexps
+that must have different modifiers:
+
+ $pattern[0] = '(?i)doctor';
+ $pattern[1] = 'Johnson';
+ ...
+ while (<>) {
+ foreach $patt (@pattern) {
+ print if /$patt/;
+ }
+ }
+
+The second advantage is that embedded modifiers only affect the regexp
+inside the group the embedded modifier is contained in. So grouping
+can be used to localize the modifier's effects:
+
+ /Answer: ((?i)yes)/; # matches 'Answer: yes', 'Answer: YES', etc.
+
+Embedded modifiers can also turn off any modifiers already present
+by using, e.g., C<(?-i)>. Modifiers can also be combined into
+a single expression, e.g., C<(?s-i)> turns on single line mode and
+turns off case insensitivity.
+
+=head2 Non-capturing groupings
+
+We noted in Part 1 that groupings C<()> had two distinct functions: 1)
+group regexp elements together as a single unit, and 2) extract, or
+capture, substrings that matched the regexp in the
+grouping. Non-capturing groupings, denoted by C<(?:regexp)>, allow the
+regexp to be treated as a single unit, but don't extract substrings or
+set matching variables C<$1>, etc. Both capturing and non-capturing
+groupings are allowed to co-exist in the same regexp. Because there is
+no extraction, non-capturing groupings are faster than capturing
+groupings. Non-capturing groupings are also handy for choosing exactly
+which parts of a regexp are to be extracted to matching variables:
+
+ # match a number, $1-$4 are set, but we only want $1
+ /([+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?)/;
+
+ # match a number faster , only $1 is set
+ /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE][+-]?\d+)?)/;
+
+ # match a number, get $1 = whole number, $2 = exponent
+ /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE]([+-]?\d+))?)/;
+
+Non-capturing groupings are also useful for removing nuisance
+elements gathered from a split operation:
+
+ $x = '12a34b5';
+ @num = split /(a|b)/, $x; # @num = ('12','a','34','b','5')
+ @num = split /(?:a|b)/, $x; # @num = ('12','34','5')
+
+Non-capturing groupings may also have embedded modifiers:
+C<(?i-m:regexp)> is a non-capturing grouping that matches C<regexp>
+case insensitively and turns off multi-line mode.
+
+=head2 Looking ahead and looking behind
+
+This section concerns the lookahead and lookbehind assertions. First,
+a little background.
+
+In Perl regular expressions, most regexp elements 'eat up' a certain
+amount of string when they match. For instance, the regexp element
+C<[abc}]> eats up one character of the string when it matches, in the
+sense that perl moves to the next character position in the string
+after the match. There are some elements, however, that don't eat up
+characters (advance the character position) if they match. The examples
+we have seen so far are the anchors. The anchor C<^> matches the
+beginning of the line, but doesn't eat any characters. Similarly, the
+word boundary anchor C<\b> matches, e.g., if the character to the left
+is a word character and the character to the right is a non-word
+character, but it doesn't eat up any characters itself. Anchors are
+examples of 'zero-width assertions'. Zero-width, because they consume
+no characters, and assertions, because they test some property of the
+string. In the context of our walk in the woods analogy to regexp
+matching, most regexp elements move us along a trail, but anchors have
+us stop a moment and check our surroundings. If the local environment
+checks out, we can proceed forward. But if the local environment
+doesn't satisfy us, we must backtrack.
+
+Checking the environment entails either looking ahead on the trail,
+looking behind, or both. C<^> looks behind, to see that there are no
+characters before. C<$> looks ahead, to see that there are no
+characters after. C<\b> looks both ahead and behind, to see if the
+characters on either side differ in their 'word'-ness.
+
+The lookahead and lookbehind assertions are generalizations of the
+anchor concept. Lookahead and lookbehind are zero-width assertions
+that let us specify which characters we want to test for. The
+lookahead assertion is denoted by C<(?=regexp)> and the lookbehind
+assertion is denoted by C<(?<=fixed-regexp)>. Some examples are
+
+ $x = "I catch the housecat 'Tom-cat' with catnip";
+ $x =~ /cat(?=\s+)/; # matches 'cat' in 'housecat'
+ @catwords = ($x =~ /(?<=\s)cat\w+/g); # matches,
+ # $catwords[0] = 'catch'
+ # $catwords[1] = 'catnip'
+ $x =~ /\bcat\b/; # matches 'cat' in 'Tom-cat'
+ $x =~ /(?<=\s)cat(?=\s)/; # doesn't match; no isolated 'cat' in
+ # middle of $x
+
+Note that the parentheses in C<(?=regexp)> and C<(?<=regexp)> are
+non-capturing, since these are zero-width assertions. Thus in the
+second regexp, the substrings captured are those of the whole regexp
+itself. Lookahead C<(?=regexp)> can match arbitrary regexps, but
+lookbehind C<(?<=fixed-regexp)> only works for regexps of fixed
+width, i.e., a fixed number of characters long. Thus C<(?<=(ab|bc))>
+is fine, but C<(?<=(ab)*)> is not. The negated versions of the
+lookahead and lookbehind assertions are denoted by C<(?!regexp)>
+and C<(?<!fixed-regexp)> respectively. They evaluate true if the
+regexps do I<not> match:
+
+ $x = "foobar";
+ $x =~ /foo(?!bar)/; # doesn't match, 'bar' follows 'foo'
+ $x =~ /foo(?!baz)/; # matches, 'baz' doesn't follow 'foo'
+ $x =~ /(?<!\s)foo/; # matches, there is no \s before 'foo'
+
+=head2 Using independent subexpressions to prevent backtracking
+
+The last few extended patterns in this tutorial are experimental as of
+5.6.0. Play with them, use them in some code, but don't rely on them
+just yet for production code.
+
+S<B<Independent subexpressions> > are regular expressions, in the
+context of a larger regular expression, that function independently of
+the larger regular expression. That is, they consume as much or as
+little of the string as they wish without regard for the ability of
+the larger regexp to match. Independent subexpressions are represented
+by C<< (?>regexp) >>. We can illustrate their behavior by first
+considering an ordinary regexp:
+
+ $x = "ab";
+ $x =~ /a*ab/; # matches
+
+This obviously matches, but in the process of matching, the
+subexpression C<a*> first grabbed the C<a>. Doing so, however,
+wouldn't allow the whole regexp to match, so after backtracking, C<a*>
+eventually gave back the C<a> and matched the empty string. Here, what
+C<a*> matched was I<dependent> on what the rest of the regexp matched.
+
+Contrast that with an independent subexpression:
+
+ $x =~ /(?>a*)ab/; # doesn't match!
+
+The independent subexpression C<< (?>a*) >> doesn't care about the rest
+of the regexp, so it sees an C<a> and grabs it. Then the rest of the
+regexp C<ab> cannot match. Because C<< (?>a*) >> is independent, there
+is no backtracking and and the independent subexpression does not give
+up its C<a>. Thus the match of the regexp as a whole fails. A similar
+behavior occurs with completely independent regexps:
+
+ $x = "ab";
+ $x =~ /a*/g; # matches, eats an 'a'
+ $x =~ /\Gab/g; # doesn't match, no 'a' available
+
+Here C<//g> and C<\G> create a 'tag team' handoff of the string from
+one regexp to the other. Regexps with an independent subexpression are
+much like this, with a handoff of the string to the independent
+subexpression, and a handoff of the string back to the enclosing
+regexp.
+
+The ability of an independent subexpression to prevent backtracking
+can be quite useful. Suppose we want to match a non-empty string
+enclosed in parentheses up to two levels deep. Then the following
+regexp matches:
+
+ $x = "abc(de(fg)h"; # unbalanced parentheses
+ $x =~ /\( ( [^()]+ | \([^()]*\) )+ \)/x;
+
+The regexp matches an open parenthesis, one or more copies of an
+alternation, and a close parenthesis. The alternation is two-way, with
+the first alternative C<[^()]+> matching a substring with no
+parentheses and the second alternative C<\([^()]*\)> matching a
+substring delimited by parentheses. The problem with this regexp is
+that it is pathological: it has nested indeterminate quantifiers
+ of the form C<(a+|b)+>. We discussed in Part 1 how nested quantifiers
+like this could take an exponentially long time to execute if there
+was no match possible. To prevent the exponential blowup, we need to
+prevent useless backtracking at some point. This can be done by
+enclosing the inner quantifier as an independent subexpression:
+
+ $x =~ /\( ( (?>[^()]+) | \([^()]*\) )+ \)/x;
+
+Here, C<< (?>[^()]+) >> breaks the degeneracy of string partitioning
+by gobbling up as much of the string as possible and keeping it. Then
+match failures fail much more quickly.
+
+=head2 Conditional expressions
+
+A S<B<conditional expression> > is a form of if-then-else statement
+that allows one to choose which patterns are to be matched, based on
+some condition. There are two types of conditional expression:
+C<(?(condition)yes-regexp)> and
+C<(?(condition)yes-regexp|no-regexp)>. C<(?(condition)yes-regexp)> is
+like an S<C<'if () {}'> > statement in Perl. If the C<condition> is true,
+the C<yes-regexp> will be matched. If the C<condition> is false, the
+C<yes-regexp> will be skipped and perl will move onto the next regexp
+element. The second form is like an S<C<'if () {} else {}'> > statement
+in Perl. If the C<condition> is true, the C<yes-regexp> will be
+matched, otherwise the C<no-regexp> will be matched.
+
+The C<condition> can have two forms. The first form is simply an
+integer in parentheses C<(integer)>. It is true if the corresponding
+backreference C<\integer> matched earlier in the regexp. The second
+form is a bare zero width assertion C<(?...)>, either a
+lookahead, a lookbehind, or a code assertion (discussed in the next
+section).
+
+The integer form of the C<condition> allows us to choose, with more
+flexibility, what to match based on what matched earlier in the
+regexp. This searches for words of the form C<"$x$x"> or
+C<"$x$y$y$x">:
+
+ % simple_grep '^(\w+)(\w+)?(?(2)\2\1|\1)$' /usr/dict/words
+ beriberi
+ coco
+ couscous
+ deed
+ ...
+ toot
+ toto
+ tutu
+
+The lookbehind C<condition> allows, along with backreferences,
+an earlier part of the match to influence a later part of the
+match. For instance,
+
+ /[ATGC]+(?(?<=AA)G|C)$/;
+
+matches a DNA sequence such that it either ends in C<AAG>, or some
+other base pair combination and C<C>. Note that the form is
+C<(?(?<=AA)G|C)> and not C<(?((?<=AA))G|C)>; for the lookahead,
+lookbehind or code assertions, the parentheses around the conditional
+are not needed.
+
+=head2 A bit of magic: executing Perl code in a regular expression
+
+Normally, regexps are a part of Perl expressions.
+S<B<Code evaluation> > expressions turn that around by allowing
+arbitrary Perl code to be a part of of a regexp. A code evaluation
+expression is denoted C<(?{code})>, with C<code> a string of Perl
+statements.
+
+Code expressions are zero-width assertions, and the value they return
+depends on their environment. There are two possibilities: either the
+code expression is used as a conditional in a conditional expression
+C<(?(condition)...)>, or it is not. If the code expression is a
+conditional, the code is evaluated and the result (i.e., the result of
+the last statement) is used to determine truth or falsehood. If the
+code expression is not used as a conditional, the assertion always
+evaluates true and the result is put into the special variable
+C<$^R>. The variable C<$^R> can then be used in code expressions later
+in the regexp. Here are some silly examples:
+
+ $x = "abcdef";
+ $x =~ /abc(?{print "Hi Mom!";})def/; # matches,
+ # prints 'Hi Mom!'
+ $x =~ /aaa(?{print "Hi Mom!";})def/; # doesn't match,
+ # no 'Hi Mom!'
+ $x =~ /abc(?{print "Hi Mom!";})ddd/; # doesn't match,
+ # no 'Hi Mom!'
+ $x =~ /(?{print "Hi Mom!";})/; # matches,
+ # prints 'Hi Mom!'
+ $x =~ /(?{$c = 1;})(?{print "$c";})/; # matches,
+ # prints '1'
+ $x =~ /(?{$c = 1;})(?{print "$^R";})/; # matches,
+ # prints '1'
+
+The bit of magic mentioned in the section title occurs when the regexp
+backtracks in the process of searching for a match. If the regexp
+backtracks over a code expression and if the variables used within are
+localized using C<local>, the changes in the variables produced by the
+code expression are undone! Thus, if we wanted to count how many times
+a character got matched inside a group, we could use, e.g.,
+
+ $x = "aaaa";
+ $count = 0; # initialize 'a' count
+ $c = "bob"; # test if $c gets clobbered
+ $x =~ /(?{local $c = 0;}) # initialize count
+ ( a # match 'a'
+ (?{local $c = $c + 1;}) # increment count
+ )* # do this any number of times,
+ aa # but match 'aa' at the end
+ (?{$count = $c;}) # copy local $c var into $count
+ /x;
+ print "'a' count is $count, \$c variable is '$c'\n";
+
+This prints
+
+ 'a' count is 2, $c variable is 'bob'
+
+If we replace the S<C< (?{local $c = $c + 1;})> > with
+S<C< (?{$c = $c + 1;})> >, the variable changes are I<not> undone
+during backtracking, and we get
+
+ 'a' count is 4, $c variable is 'bob'
+
+Note that only localized variable changes are undone. Other side
+effects of code expression execution are permanent. Thus
+
+ $x = "aaaa";
+ $x =~ /(a(?{print "Yow\n";}))*aa/;
+
+produces
+
+ Yow
+ Yow
+ Yow
+ Yow
+
+The result C<$^R> is automatically localized, so that it will behave
+properly in the presence of backtracking.
+
+This example uses a code expression in a conditional to match the
+article 'the' in either English or German:
+
+ use re 'eval';
+ $lang = 'DE'; # use German
+ ...
+ $text = "das";
+ print "matched\n"
+ if $text =~ /(?(?{
+ $lang eq 'EN'; # is the language English?
+ })
+ the | # if so, then match 'the'
+ (die|das|der) # else, match 'die|das|der'
+ )
+ /xi;
+
+Note that the syntax here is C<(?(?{...})yes-regexp|no-regexp)>, not
+C<(?((?{...}))yes-regexp|no-regexp)>. In other words, in the case of a
+code expression, we don't need the extra parentheses around the
+conditional.
+
+The S<C<use re 'eval';> > statement is needed because we are both
+interpolating the variable C<$lang> I<and> evaluating code
+within the regexp. From a security point of view, this can be
+dangerous. It is dangerous because many programmers who write search
+engines often take user input and plug it directly into a regexp:
+
+ $regexp = <>; # read user-supplied regexp
+ $chomp $regexp; # get rid of possible newline
+ $text =~ /$regexp/; # search $text for the $regexp
+
+If the C<$regexp> variable is used in a code expression, the user
+could then execute arbitrary Perl code. For instance, some joker could
+search for S<C<system('rm -rf *');> > to erase your files. In this
+sense, the combination of interpolation and code expressions B<taints>
+your regexp. So by default, using both interpolation and code
+expressions in the same regexp is not allowed. Only by invoking
+S<C<use re 'eval';> > can one use both interpolation and code
+expressions in the same regexp.
+
+Another form of code expression is the S<B<pattern code expression> >.
+The pattern code expression is like a regular code expression, except
+that the result of the code evaluation is treated as a regular
+expression and matched immediately. A simple example is
+
+ $length = 5;
+ $char = 'a';
+ $x = 'aaaaabb';
+ $x =~ /(??{$char x $length})/x; # matches, there are 5 of 'a'
+
+
+This final example contains both ordinary and pattern code
+expressions. It detects if a binary string C<1101010010001...> has a
+Fibonacci spacing 0,1,1,2,3,5,... of the C<1>'s:
+
+ use re 'eval';
+ $s0 = 0; $s1 = 1; # initial conditions
+ $x = "1101010010001000001";
+ print "It is a Fibonacci sequence\n"
+ if $x =~ /^1 # match an initial '1'
+ (
+ (??{'0' x $s0}) # match $s0 of '0'
+ 1 # and then a '1'
+ (?{
+ $largest = $s0; # largest seq so far
+ $s2 = $s1 + $s0; # compute next term
+ $s0 = $s1; # in Fibonacci sequence
+ $s1 = $s2;
+ })
+ )+ # repeat as needed
+ $ # that is all there is
+ /x;
+ print "Largest sequence matched was $largest\n";
+
+This prints
+
+ It is a Fibonacci sequence
+ Largest sequence matched was 5
+
+Ha! Try that with your garden variety regexp package...
+
+Note that the variables C<$s0> and C<$s1> are not substituted when the
+regexp is compiled, as happens for ordinary variables outside a code
+expression. Rather, the code expressions are evaluated when perl
+encounters them during the search for a match.
+
+The regexp without the C<//x> modifier is
+
+ /^1((??{'0'x$s0})1(?{$largest=$s0;$s2=$s1+$s0$s0=$s1;$s1=$s2;}))+$/;
+
+and is a great start on an Obfuscated Perl entry :-) When working with
+code and conditional expressions, the extended form of regexps is
+almost necessary in creating and debugging regexps.
+
+=head2 Pragmas and debugging
+
+Speaking of debugging, there are several pragmas available to control
+and debug regexps in Perl. We have already encountered one pragma in
+the previous section, S<C<use re 'eval';> >, that allows variable
+interpolation in a regexp with code expressions. The other pragmas are
+
+ use re 'taint';
+ $tainted = <>;
+ @parts = ($tainted =~ /(\w+)\s+(\w+)/; # @parts is now tainted
+
+The C<taint> pragma causes any substrings from a match with a tainted
+variable to be tainted as well. This is not normally the case, as
+regexps are often used to extract the safe bits from a tainted
+variable. Use C<taint> when you are not extracting safe bits, but are
+performing some other processing. Both C<taint> and C<eval> pragmas
+are lexically scoped, which mean they have are in effect only until
+the end of the block enclosing the pragmas.
+
+ use re 'debug';
+ /^(.*)$/s; # output debugging info
+
+ use re 'debugcolor';
+ /^(.*)$/s; # output debugging info in living color
+
+The global C<debug> and C<debugcolor> pragmas allow one to get
+detailed debugging info about regexp compilation and
+execution. C<debugcolor> is the same as debug, except the debugging
+information is displayed in color on terminals that can display
+termcap color sequences. Here is example output:
+
+ % perl -e 'use re "debug"; "abc" =~ /a*b+c/;'
+ Compiling REx `a*b+c'
+ size 9 first at 1
+ 1: STAR(4)
+ 2: EXACT <a>(0)
+ 4: PLUS(7)
+ 5: EXACT <b>(0)
+ 7: EXACT <c>(9)
+ 9: END(0)
+ floating `bc' at 0..2147483647 (checking floating) minlen 2
+ Guessing start of match, REx `a*b+c' against `abc'...
+ Found floating substr `bc' at offset 1...
+ Guessed: match at offset 0
+ Matching REx `a*b+c' against `abc'
+ Setting an EVAL scope, savestack=3
+ 0 <> <abc> | 1: STAR
+ EXACT <a> can match 1 times out of 32767...
+ Setting an EVAL scope, savestack=3
+ 1 <a> <bc> | 4: PLUS
+ EXACT <b> can match 1 times out of 32767...
+ Setting an EVAL scope, savestack=3
+ 2 <ab> <c> | 7: EXACT <c>
+ 3 <abc> <> | 9: END
+ Match successful!
+ Freeing REx: `a*b+c'
+
+If you have gotten this far into the tutorial, you can probably guess
+what the different parts of the debugging output tell you. The first
+part
+
+ Compiling REx `a*b+c'
+ size 9 first at 1
+ 1: STAR(4)
+ 2: EXACT <a>(0)
+ 4: PLUS(7)
+ 5: EXACT <b>(0)
+ 7: EXACT <c>(9)
+ 9: END(0)
+
+describes the compilation stage. C<STAR(4)> means that there is a
+starred object, in this case C<'a'>, and if it matches, goto line 4,
+i.e., C<PLUS(7)>. The middle lines describe some heuristics and
+optimizations performed before a match:
+
+ floating `bc' at 0..2147483647 (checking floating) minlen 2
+ Guessing start of match, REx `a*b+c' against `abc'...
+ Found floating substr `bc' at offset 1...
+ Guessed: match at offset 0
+
+Then the match is executed and the remaining lines describe the
+process:
+
+ Matching REx `a*b+c' against `abc'
+ Setting an EVAL scope, savestack=3
+ 0 <> <abc> | 1: STAR
+ EXACT <a> can match 1 times out of 32767...
+ Setting an EVAL scope, savestack=3
+ 1 <a> <bc> | 4: PLUS
+ EXACT <b> can match 1 times out of 32767...
+ Setting an EVAL scope, savestack=3
+ 2 <ab> <c> | 7: EXACT <c>
+ 3 <abc> <> | 9: END
+ Match successful!
+ Freeing REx: `a*b+c'
+
+Each step is of the form S<C<< n <x> <y> >> >, with C<< <x> >> the
+part of the string matched and C<< <y> >> the part not yet
+matched. The S<C<< | 1: STAR >> > says that perl is at line number 1
+n the compilation list above. See
+L<perldebguts/"Debugging regular expressions"> for much more detail.
+
+An alternative method of debugging regexps is to embed C<print>
+statements within the regexp. This provides a blow-by-blow account of
+the backtracking in an alternation:
+
+ "that this" =~ m@(?{print "Start at position ", pos, "\n";})
+ t(?{print "t1\n";})
+ h(?{print "h1\n";})
+ i(?{print "i1\n";})
+ s(?{print "s1\n";})
+ |
+ t(?{print "t2\n";})
+ h(?{print "h2\n";})
+ a(?{print "a2\n";})
+ t(?{print "t2\n";})
+ (?{print "Done at position ", pos, "\n";})
+ @x;
+
+prints
+
+ Start at position 0
+ t1
+ h1
+ t2
+ h2
+ a2
+ t2
+ Done at position 4
+
+=head1 BUGS
+
+Code expressions, conditional expressions, and independent expressions
+are B<experimental>. Don't use them in production code. Yet.
+
+=head1 SEE ALSO
+
+This is just a tutorial. For the full story on perl regular
+expressions, see the L<perlre> regular expressions reference page.
+
+For more information on the matching C<m//> and substitution C<s///>
+operators, see L<perlop/"Regexp Quote-Like Operators">. For
+information on the C<split> operation, see L<perlfunc/split>.
+
+For an excellent all-around resource on the care and feeding of
+regular expressions, see the book I<Mastering Regular Expressions> by
+Jeffrey Friedl (published by O'Reilly, ISBN 1556592-257-3).
+
+=head1 AUTHOR AND COPYRIGHT
+
+Copyright (c) 2000 Mark Kvale
+All rights reserved.
+
+This document may be distributed under the same terms as Perl itself.
+
+=head2 Acknowledgments
+
+The inspiration for the stop codon DNA example came from the ZIP
+code example in chapter 7 of I<Mastering Regular Expressions>.
+
+The author would like to thank
+Jeff Pinyan,
+Peter Haworth,
+Ronald J Kimball,
+and Joe Smith for all their helpful comments.
+
+=cut
projects / p5sagit/p5-mst-13.2.git / commitdiff