X-Git-Url: http://git.shadowcat.co.uk/gitweb/gitweb.cgi?a=blobdiff_plain;f=pod%2Fperlretut.pod;h=6e06f192914b95af82e9cb85856ac46daf6a111f;hb=c23d1eb0e18a49361001d26c686323d50b0c6d21;hp=87669e50ab0636a8ecc41d789e660b1cf8391253;hpb=aaa51d5e11b8b0db616a7f939c784733b4cfef87;p=p5sagit%2Fp5-mst-13.2.git diff --git a/pod/perlretut.pod b/pod/perlretut.pod index 87669e5..6e06f19 100644 --- a/pod/perlretut.pod +++ b/pod/perlretut.pod @@ -306,7 +306,7 @@ string is the earliest point at which the regexp can match. /[yY][eE][sS]/; # match 'yes' in a case-insensitive way # 'yes', 'Yes', 'YES', etc. -This regexp displays a common task: perform a a case-insensitive +This regexp displays a common task: perform a case-insensitive match. Perl provides away of avoiding all those brackets by simply appending an C<'i'> to the end of the match. Then C can be rewritten as C. The C<'i'> stands for @@ -368,24 +368,31 @@ has several abbreviations for common character classes: =over 4 =item * + \d is a digit and represents [0-9] =item * + \s is a whitespace character and represents [\ \t\r\n\f] =item * + \w is a word character (alphanumeric or _) and represents [0-9a-zA-Z_] =item * + \D is a negated \d; it represents any character but a digit [^0-9] =item * + \S is a negated \s; it represents any non-whitespace character [^\s] =item * + \W is a negated \w; it represents any non-word character [^\w] =item * + The period '.' matches any character but "\n" =back @@ -451,22 +458,26 @@ and C<$> are able to match. Here are the four possible combinations: =over 4 =item * + no modifiers (//): Default behavior. C<'.'> matches any character except C<"\n">. C<^> matches only at the beginning of the string and C<$> matches only at the end or before a newline at the end. =item * + s modifier (//s): Treat string as a single long line. C<'.'> matches any character, even C<"\n">. C<^> matches only at the beginning of the string and C<$> matches only at the end or before a newline at the end. =item * + m modifier (//m): Treat string as a set of multiple lines. C<'.'> matches any character except C<"\n">. C<^> and C<$> are able to match at the start or end of I line within the string. =item * + both s and m modifiers (//sm): Treat string as a single long line, but detect multiple lines. C<'.'> matches any character, even C<"\n">. C<^> and C<$>, however, are able to match at the start or end @@ -539,7 +550,7 @@ to give them a chance to match. The last example points out that character classes are like alternations of characters. At a given character position, the first -alternative that allows the regexp match to succeed wil be the one +alternative that allows the regexp match to succeed will be the one that matches. =head2 Grouping things and hierarchical matching @@ -550,7 +561,7 @@ regexp, but sometime we want alternatives for just part of a regexp. For instance, suppose we want to search for housecats or housekeepers. The regexp C fits the bill, but is inefficient because we had to type C twice. It would be nice to -have parts of the regexp be constant, like C, and and some +have parts of the regexp be constant, like C, and some parts have alternatives, like C. The B metacharacters C<()> solve this problem. Grouping @@ -576,7 +587,7 @@ are Alternations behave the same way in groups as out of them: at a given string position, the leftmost alternative that allows the regexp to -match is taken. So in the last example at tth first string position, +match is taken. So in the last example at the first string position, C<"20"> matches the second alternative, but there is nothing left over to match the next two digits C<\d\d>. So perl moves on to the next alternative, which is the null alternative and that works, since @@ -602,32 +613,52 @@ of what perl does when it tries to match the regexp =over 4 -=item 0 Start with the first letter in the string 'a'. +=item 0 -=item 1 Try the first alternative in the first group 'abd'. +Start with the first letter in the string 'a'. -=item 2 Match 'a' followed by 'b'. So far so good. +=item 1 -=item 3 'd' in the regexp doesn't match 'c' in the string - a dead +Try the first alternative in the first group 'abd'. + +=item 2 + +Match 'a' followed by 'b'. So far so good. + +=item 3 + +'d' in the regexp doesn't match 'c' in the string - a dead end. So backtrack two characters and pick the second alternative in the first group 'abc'. -=item 4 Match 'a' followed by 'b' followed by 'c'. We are on a roll +=item 4 + +Match 'a' followed by 'b' followed by 'c'. We are on a roll and have satisfied the first group. Set $1 to 'abc'. -=item 5 Move on to the second group and pick the first alternative +=item 5 + +Move on to the second group and pick the first alternative 'df'. -=item 6 Match the 'd'. +=item 6 + +Match the 'd'. + +=item 7 -=item 7 'f' in the regexp doesn't match 'e' in the string, so a dead +'f' in the regexp doesn't match 'e' in the string, so a dead end. Backtrack one character and pick the second alternative in the second group 'd'. -=item 8 'd' matches. The second grouping is satisfied, so set $2 to +=item 8 + +'d' matches. The second grouping is satisfied, so set $2 to 'd'. -=item 9 We are at the end of the regexp, so we are done! We have +=item 9 + +We are at the end of the regexp, so we are done! We have matched 'abcd' out of the string "abcde". =back @@ -639,7 +670,7 @@ wins. Second, we were able to get a match at the first character position of the string 'a'. If there were no matches at the first position, perl would move to the second character position 'b' and attempt the match all over again. Only when all possible paths at all -possible character positions have been exhausted does perl give give +possible character positions have been exhausted does perl give up and declare S > to be false. Even with all this work, regexp matching happens remarkably fast. To @@ -658,10 +689,11 @@ inside goes into the special variables C<$1>, C<$2>, etc. They can be used just as ordinary variables: # extract hours, minutes, seconds - $time =~ /(\d\d):(\d\d):(\d\d)/; # match hh:mm:ss format - $hours = $1; - $minutes = $2; - $seconds = $3; + if ($time =~ /(\d\d):(\d\d):(\d\d)/) { # match hh:mm:ss format + $hours = $1; + $minutes = $2; + $seconds = $3; + } Now, we know that in scalar context, S > returns a true or false @@ -679,9 +711,12 @@ indicated below it: /(ab(cd|ef)((gi)|j))/; 1 2 34 -so that if the regexp matched, e.g., C<$2> would contain 'cd' or 'ef'. -For convenience, perl sets C<$+> to the highest numbered C<$1>, C<$2>, -... that got assigned. +so that if the regexp matched, e.g., C<$2> would contain 'cd' or 'ef'. For +convenience, perl sets C<$+> to the string held by the highest numbered +C<$1>, C<$2>, ... that got assigned (and, somewhat related, C<$^N> to the +value of the C<$1>, C<$2>, ... most-recently assigned; i.e. the C<$1>, +C<$2>, ... associated with the rightmost closing parenthesis used in the +match). Closely associated with the matching variables C<$1>, C<$2>, ... are the B C<\1>, C<\2>, ... . Backreferences are simply @@ -770,18 +805,30 @@ meanings: =over 4 -=item * C = match 'a' 1 or 0 times +=item * + +C = match 'a' 1 or 0 times + +=item * + +C = match 'a' 0 or more times, i.e., any number of times -=item * C = match 'a' 0 or more times, i.e., any number of times +=item * -=item * C = match 'a' 1 or more times, i.e., at least once +C = match 'a' 1 or more times, i.e., at least once -=item * C = match at least C times, but not more than C +=item * + +C = match at least C times, but not more than C times. -=item * C = match at least C or more times +=item * + +C = match at least C or more times + +=item * -=item * C = match exactly C times +C = match exactly C times =back @@ -845,19 +892,23 @@ the principles above to predict which way the regexp will match: =over 4 =item * + Principle 0: Taken as a whole, any regexp will be matched at the earliest possible position in the string. =item * + Principle 1: In an alternation C, the leftmost alternative that allows a match for the whole regexp will be the one used. =item * + Principle 2: The maximal matching quantifiers C, C<*>, C<+> and C<{n,m}> will in general match as much of the string as possible while still allowing the whole regexp to match. =item * + Principle 3: If there are two or more elements in a regexp, the leftmost greedy quantifier, if any, will match as much of the string as possible while still allowing the whole regexp to match. The next @@ -925,21 +976,33 @@ following meanings: =over 4 -=item * C = match 'a' 0 or 1 times. Try 0 first, then 1. +=item * + +C = match 'a' 0 or 1 times. Try 0 first, then 1. + +=item * -=item * C = match 'a' 0 or more times, i.e., any number of times, +C = match 'a' 0 or more times, i.e., any number of times, but as few times as possible -=item * C = match 'a' 1 or more times, i.e., at least once, but +=item * + +C = match 'a' 1 or more times, i.e., at least once, but as few times as possible -=item * C = match at least C times, not more than C +=item * + +C = match at least C times, not more than C times, as few times as possible -=item * C = match at least C times, but as few times as +=item * + +C = match at least C times, but as few times as possible -=item * C = match exactly C times. Because we match exactly +=item * + +C = match exactly C times. Because we match exactly C times, C is equivalent to C and is just there for notational consistency. @@ -998,6 +1061,7 @@ quantifiers: =over 4 =item * + Principle 3: If there are two or more elements in a regexp, the leftmost greedy (non-greedy) quantifier, if any, will match as much (little) of the string as possible while still allowing the whole @@ -1019,23 +1083,37 @@ backtracking. Here is a step-by-step analysis of the example =over 4 -=item 0 Start with the first letter in the string 't'. +=item 0 + +Start with the first letter in the string 't'. -=item 1 The first quantifier '.*' starts out by matching the whole +=item 1 + +The first quantifier '.*' starts out by matching the whole string 'the cat in the hat'. -=item 2 'a' in the regexp element 'at' doesn't match the end of the +=item 2 + +'a' in the regexp element 'at' doesn't match the end of the string. Backtrack one character. -=item 3 'a' in the regexp element 'at' still doesn't match the last +=item 3 + +'a' in the regexp element 'at' still doesn't match the last letter of the string 't', so backtrack one more character. -=item 4 Now we can match the 'a' and the 't'. +=item 4 + +Now we can match the 'a' and the 't'. + +=item 5 -=item 5 Move on to the third element '.*'. Since we are at the end of +Move on to the third element '.*'. Since we are at the end of the string and '.*' can match 0 times, assign it the empty string. -=item 6 We are done! +=item 6 + +We are done! =back @@ -1180,15 +1258,25 @@ This is our final regexp. To recap, we built a regexp by =over 4 -=item * specifying the task in detail, +=item * -=item * breaking down the problem into smaller parts, +specifying the task in detail, -=item * translating the small parts into regexps, +=item * -=item * combining the regexps, +breaking down the problem into smaller parts, + +=item * -=item * and optimizing the final combined regexp. +translating the small parts into regexps, + +=item * + +combining the regexps, + +=item * + +and optimizing the final combined regexp. =back @@ -1249,7 +1337,7 @@ the regexp in the I is used instead. So we have "dogbert =~ //; # this matches the 'd' regexp used before The final two modifiers C and C concern multiple matches. -The modifier C stands for global matching and allows the the +The modifier C stands for global matching and allows the matching operator to match within a string as many times as possible. In scalar context, successive invocations against a string will have `C jump from match to match, keeping track of position in the @@ -1316,6 +1404,8 @@ off. C<\G> allows us to easily do context-sensitive matching: The combination of C and C<\G> allows us to process the string a bit at a time and use arbitrary Perl logic to decide what to do next. +Currently, the C<\G> anchor is only fully supported when used to anchor +to the start of the pattern. C<\G> is also invaluable in processing fixed length records with regexps. Suppose we have a snippet of coding region DNA, encoded as @@ -1328,7 +1418,7 @@ naive regexp $dna = "ATCGTTGAATGCAAATGACATGAC"; $dna =~ /TGA/; -doesn't work; it may match an C, but there is no guarantee that +doesn't work; it may match a C, but there is no guarantee that the match is aligned with codon boundaries, e.g., the substring S > gives a match. A better solution is @@ -1498,7 +1588,7 @@ OK, you know the basics of regexps and you want to know more. If matching regular expressions is analogous to a walk in the woods, then the tools discussed in Part 1 are analogous to topo maps and a compass, basic tools we use all the time. Most of the tools in part 2 -are are analogous to flare guns and satellite phones. They aren't used +are analogous to flare guns and satellite phones. They aren't used too often on a hike, but when we are stuck, they can be invaluable. What follows are the more advanced, less used, or sometimes esoteric @@ -1560,13 +1650,17 @@ sequence of bytes (the old way) or as a sequence of Unicode characters than C may be represented using the C<\x{hex}> notation, with C a hexadecimal integer: - use utf8; # We will be doing Unicode processing /\x{263a}/; # match a Unicode smiley face :) Unicode characters in the range of 128-255 use two hexadecimal digits with braces: C<\x{ab}>. Note that this is different than C<\xab>, -which is just a hexadecimal byte with no Unicode -significance. +which is just a hexadecimal byte with no Unicode significance. + +B: in Perl 5.6.0 it used to be that one needed to say C to use any Unicode features. This is no more the case: for +almost all Unicode processing, the explicit C pragma is not +needed. (The only case where it matters is if your Perl script is in +Unicode and encoded in UTF-8, then an explicit C is needed.) Figuring out the hexadecimal sequence of a Unicode character you want or deciphering someone else's hexadecimal Unicode regexp is about as @@ -1577,15 +1671,12 @@ specified in the Unicode standard. For instance, if we wanted to represent or match the astrological sign for the planet Mercury, we could use - use utf8; # We will be doing Unicode processing use charnames ":full"; # use named chars with Unicode full names $x = "abc\N{MERCURY}def"; $x =~ /\N{MERCURY}/; # matches One can also use short names or restrict names to a certain alphabet: - use utf8; # We will be doing Unicode processing - use charnames ':full'; print "\N{GREEK SMALL LETTER SIGMA} is called sigma.\n"; @@ -1596,7 +1687,7 @@ One can also use short names or restrict names to a certain alphabet: print "\N{sigma} is Greek sigma\n"; A list of full names is found in the file Names.txt in the -lib/perl5/5.6.0/unicode directory. +lib/perl5/5.X.X/unicore directory. The answer to requirement 2), as of 5.6.0, is that if a regexp contains Unicode characters, the string is searched as a sequence of @@ -1606,7 +1697,6 @@ characters, but matching a single byte is required, we can use the C<\C> escape sequence. C<\C> is a character class akin to C<.> except that it matches I byte 0-255. So - use utf8; # We will be doing Unicode processing use charnames ":full"; # use named chars with Unicode full names $x = "a"; $x =~ /\C/; # matches 'a', eats one byte @@ -1618,7 +1708,7 @@ it matches I byte 0-255. So The last regexp matches, but is dangerous because the string I position is no longer synchronized to the string I position. This generates the warning 'Malformed UTF-8 -character'. C<\C> is best used for matching the binary data in strings +character'. The C<\C> is best used for matching the binary data in strings with binary data intermixed with Unicode characters. Let us now discuss the rest of the character classes. Just as with @@ -1628,7 +1718,6 @@ the C<\P{name}> character class, which is the negation of the C<\p{name}> class. For example, to match lower and uppercase characters, - use utf8; # We will be doing Unicode processing use charnames ":full"; # use named chars with Unicode full names $x = "BOB"; $x =~ /^\p{IsUpper}/; # matches, uppercase char class @@ -1636,29 +1725,38 @@ characters, $x =~ /^\p{IsLower}/; # doesn't match, lowercase char class $x =~ /^\P{IsLower}/; # matches, char class sans lowercase -If a C is just one letter, the braces can be dropped. For -instance, C<\pM> is the character class of Unicode 'marks'. Here is -the association between some Perl named classes and the traditional -Unicode classes: +Here is the association between some Perl named classes and the +traditional Unicode classes: - Perl class name Unicode class name + Perl class name Unicode class name or regular expression - IsAlpha Lu, Ll, or Lo - IsAlnum Lu, Ll, Lo, or Nd - IsASCII $code le 127 - IsCntrl C + IsAlpha /^[LM]/ + IsAlnum /^[LMN]/ + IsASCII $code <= 127 + IsCntrl /^C/ + IsBlank $code =~ /^(0020|0009)$/ || /^Z[^lp]/ IsDigit Nd - IsGraph [^C] and $code ne "0020" + IsGraph /^([LMNPS]|Co)/ IsLower Ll - IsPrint [^C] - IsPunct P - IsSpace Z, or ($code lt "0020" and chr(hex $code) is a \s) - IsUpper Lu - IsWord Lu, Ll, Lo, Nd or $code eq "005F" + IsPrint /^([LMNPS]|Co|Zs)/ + IsPunct /^P/ + IsSpace /^Z/ || ($code =~ /^(0009|000A|000B|000C|000D)$/ + IsSpacePerl /^Z/ || ($code =~ /^(0009|000A|000C|000D|0085|2028|2029)$/ + IsUpper /^L[ut]/ + IsWord /^[LMN]/ || $code eq "005F" IsXDigit $code =~ /^00(3[0-9]|[46][1-6])$/ -For a full list of Perl class names, consult the mktables.PL program -in the lib/perl5/5.6.0/unicode directory. +You can also use the official Unicode class names with the C<\p> and +C<\P>, like C<\p{L}> for Unicode 'letters', or C<\p{Lu}> for uppercase +letters, or C<\P{Nd}> for non-digits. If a C is just one +letter, the braces can be dropped. For instance, C<\pM> is the +character class of Unicode 'marks', for example accent marks. +For the full list see L. + +The Unicode has also been separated into various sets of charaters +which you can test with C<\p{In...}> (in) and C<\P{In...}> (not in), +for example C<\p{Latin}>, C<\p{Greek}>, or C<\P{Katakana}>. +For the full list see L. C<\X> is an abbreviation for a character class sequence that includes the Unicode 'combining character sequences'. A 'combining character @@ -1670,6 +1768,9 @@ S >, which translates in Danish to A with the circle atop it, as in the word Angstrom. C<\X> is equivalent to C<\PM\pM*}>, i.e., a non-mark followed by one or more marks. +For the full and latest information about Unicode see the latest +Unicode standard, or the Unicode Consortium's website http://www.unicode.org/ + As if all those classes weren't enough, Perl also defines POSIX style character classes. These have the form C<[:name:]>, with C the name of the POSIX class. The POSIX classes are C, C, @@ -1684,12 +1785,12 @@ C<[:space:]> correspond to the familiar C<\d>, C<\w>, and C<\s> character classes. To negate a POSIX class, put a C<^> in front of the name, so that, e.g., C<[:^digit:]> corresponds to C<\D> and under C, C<\P{IsDigit}>. The Unicode and POSIX character classes can -be used just like C<\d>, both inside and outside of character classes: +be used just like C<\d>, with the exception that POSIX character +classes can only be used inside of a character class: /\s+[abc[:digit:]xyz]\s*/; # match a,b,c,x,y,z, or a digit - /^=item\s[:digit:]/; # match '=item', + /^=item\s[[:digit:]]/; # match '=item', # followed by a space and a digit - use utf8; use charnames ":full"; /\s+[abc\p{IsDigit}xyz]\s+/; # match a,b,c,x,y,z, or a digit /^=item\s\p{IsDigit}/; # match '=item', @@ -1904,6 +2005,10 @@ They evaluate true if the regexps do I match: $x =~ /foo(?!baz)/; # matches, 'baz' doesn't follow 'foo' $x =~ /(? is unsupported in lookbehind, because the already +treacherous definition of C<\C> would become even more so +when going backwards. + =head2 Using independent subexpressions to prevent backtracking The last few extended patterns in this tutorial are experimental as of @@ -1934,7 +2039,7 @@ Contrast that with an independent subexpression: The independent subexpression C<< (?>a*) >> doesn't care about the rest of the regexp, so it sees an C and grabs it. Then the rest of the regexp C cannot match. Because C<< (?>a*) >> is independent, there -is no backtracking and and the independent subexpression does not give +is no backtracking and the independent subexpression does not give up its C. Thus the match of the regexp as a whole fails. A similar behavior occurs with completely independent regexps: @@ -1962,7 +2067,7 @@ the first alternative C<[^()]+> matching a substring with no parentheses and the second alternative C<\([^()]*\)> matching a substring delimited by parentheses. The problem with this regexp is that it is pathological: it has nested indeterminate quantifiers - of the form C<(a+|b)+>. We discussed in Part 1 how nested quantifiers +of the form C<(a+|b)+>. We discussed in Part 1 how nested quantifiers like this could take an exponentially long time to execute if there was no match possible. To prevent the exponential blowup, we need to prevent useless backtracking at some point. This can be done by @@ -2026,7 +2131,7 @@ conditional are not needed. Normally, regexps are a part of Perl expressions. S > expressions turn that around by allowing -arbitrary Perl code to be a part of of a regexp. A code evaluation +arbitrary Perl code to be a part of a regexp. A code evaluation expression is denoted C<(?{code})>, with C a string of Perl statements. @@ -2046,8 +2151,41 @@ in the regexp. Here are some silly examples: # prints 'Hi Mom!' $x =~ /aaa(?{print "Hi Mom!";})def/; # doesn't match, # no 'Hi Mom!' + +Pay careful attention to the next example: + $x =~ /abc(?{print "Hi Mom!";})ddd/; # doesn't match, # no 'Hi Mom!' + # but why not? + +At first glance, you'd think that it shouldn't print, because obviously +the C isn't going to match the target string. But look at this +example: + + $x =~ /abc(?{print "Hi Mom!";})[d]dd/; # doesn't match, + # but _does_ print + +Hmm. What happened here? If you've been following along, you know that +the above pattern should be effectively the same as the last one -- +enclosing the d in a character class isn't going to change what it +matches. So why does the first not print while the second one does? + +The answer lies in the optimizations the REx engine makes. In the first +case, all the engine sees are plain old characters (aside from the +C construct). It's smart enough to realize that the string 'ddd' +doesn't occur in our target string before actually running the pattern +through. But in the second case, we've tricked it into thinking that our +pattern is more complicated than it is. It takes a look, sees our +character class, and decides that it will have to actually run the +pattern to determine whether or not it matches, and in the process of +running it hits the print statement before it discovers that we don't +have a match. + +To take a closer look at how the engine does optimizations, see the +section L<"Pragmas and debugging"> below. + +More fun with C: + $x =~ /(?{print "Hi Mom!";})/; # matches, # prints 'Hi Mom!' $x =~ /(?{$c = 1;})(?{print "$c";})/; # matches,