X-Git-Url: http://git.shadowcat.co.uk/gitweb/gitweb.cgi?a=blobdiff_plain;f=pod%2Fperlretut.pod;h=6e06f192914b95af82e9cb85856ac46daf6a111f;hb=a5365663f59d38ce50a53f9b46b25daa36d5ab17;hp=cc8f5c4c9ba169edfc1a94a9c582655d75acd022;hpb=da75cd15705fec9f427a4cc8a647f3b6919c6e04;p=p5sagit%2Fp5-mst-13.2.git
diff --git a/pod/perlretut.pod b/pod/perlretut.pod
index cc8f5c4..6e06f19 100644
--- a/pod/perlretut.pod
+++ b/pod/perlretut.pod
@@ -550,7 +550,7 @@ to give them a chance to match.
The last example points out that character classes are like
alternations of characters. At a given character position, the first
-alternative that allows the regexp match to succeed wil be the one
+alternative that allows the regexp match to succeed will be the one
that matches.
=head2 Grouping things and hierarchical matching
@@ -587,7 +587,7 @@ are
Alternations behave the same way in groups as out of them: at a given
string position, the leftmost alternative that allows the regexp to
-match is taken. So in the last example at tth first string position,
+match is taken. So in the last example at the first string position,
C<"20"> matches the second alternative, but there is nothing left over
to match the next two digits C<\d\d>. So perl moves on to the next
alternative, which is the null alternative and that works, since
@@ -689,10 +689,11 @@ inside goes into the special variables C<$1>, C<$2>, etc. They can be
used just as ordinary variables:
# extract hours, minutes, seconds
- $time =~ /(\d\d):(\d\d):(\d\d)/; # match hh:mm:ss format
- $hours = $1;
- $minutes = $2;
- $seconds = $3;
+ if ($time =~ /(\d\d):(\d\d):(\d\d)/) { # match hh:mm:ss format
+ $hours = $1;
+ $minutes = $2;
+ $seconds = $3;
+ }
Now, we know that in scalar context,
S > returns a true or false
@@ -1403,6 +1404,8 @@ off. C<\G> allows us to easily do context-sensitive matching:
The combination of C/g> and C<\G> allows us to process the string a
bit at a time and use arbitrary Perl logic to decide what to do next.
+Currently, the C<\G> anchor is only fully supported when used to anchor
+to the start of the pattern.
C<\G> is also invaluable in processing fixed length records with
regexps. Suppose we have a snippet of coding region DNA, encoded as
@@ -1415,7 +1418,7 @@ naive regexp
$dna = "ATCGTTGAATGCAAATGACATGAC";
$dna =~ /TGA/;
-doesn't work; it may match an C, but there is no guarantee that
+doesn't work; it may match a C, but there is no guarantee that
the match is aligned with codon boundaries, e.g., the substring
S > gives a match. A better solution is
@@ -1653,12 +1656,11 @@ Unicode characters in the range of 128-255 use two hexadecimal digits
with braces: C<\x{ab}>. Note that this is different than C<\xab>,
which is just a hexadecimal byte with no Unicode significance.
-B: in perl 5.6.0 it used to be that one needed to say C