/[yY][eE][sS]/; # match 'yes' in a case-insensitive way
# 'yes', 'Yes', 'YES', etc.
-This regexp displays a common task: perform a a case-insensitive
+This regexp displays a common task: perform a case-insensitive
match. Perl provides away of avoiding all those brackets by simply
appending an C<'i'> to the end of the match. Then C</[yY][eE][sS]/;>
can be rewritten as C</yes/i;>. The C<'i'> stands for
The last example points out that character classes are like
alternations of characters. At a given character position, the first
-alternative that allows the regexp match to succeed wil be the one
+alternative that allows the regexp match to succeed will be the one
that matches.
=head2 Grouping things and hierarchical matching
regexp. For instance, suppose we want to search for housecats or
housekeepers. The regexp C<housecat|housekeeper> fits the bill, but is
inefficient because we had to type C<house> twice. It would be nice to
-have parts of the regexp be constant, like C<house>, and and some
+have parts of the regexp be constant, like C<house>, and some
parts have alternatives, like C<cat|keeper>.
The B<grouping> metacharacters C<()> solve this problem. Grouping
Alternations behave the same way in groups as out of them: at a given
string position, the leftmost alternative that allows the regexp to
-match is taken. So in the last example at tth first string position,
+match is taken. So in the last example at the first string position,
C<"20"> matches the second alternative, but there is nothing left over
to match the next two digits C<\d\d>. So perl moves on to the next
alternative, which is the null alternative and that works, since
position of the string 'a'. If there were no matches at the first
position, perl would move to the second character position 'b' and
attempt the match all over again. Only when all possible paths at all
-possible character positions have been exhausted does perl give give
+possible character positions have been exhausted does perl give
up and declare S<C<$string =~ /(abd|abc)(df|d|de)/;> > to be false.
Even with all this work, regexp matching happens remarkably fast. To
"dogbert =~ //; # this matches the 'd' regexp used before
The final two modifiers C<//g> and C<//c> concern multiple matches.
-The modifier C<//g> stands for global matching and allows the the
+The modifier C<//g> stands for global matching and allows the
matching operator to match within a string as many times as possible.
In scalar context, successive invocations against a string will have
`C<//g> jump from match to match, keeping track of position in the
The combination of C<//g> and C<\G> allows us to process the string a
bit at a time and use arbitrary Perl logic to decide what to do next.
+Currently, the C<\G> anchor is only fully supported when used to anchor
+to the start of the pattern.
C<\G> is also invaluable in processing fixed length records with
regexps. Suppose we have a snippet of coding region DNA, encoded as
$dna = "ATCGTTGAATGCAAATGACATGAC";
$dna =~ /TGA/;
-doesn't work; it may match an C<TGA>, but there is no guarantee that
+doesn't work; it may match a C<TGA>, but there is no guarantee that
the match is aligned with codon boundaries, e.g., the substring
S<C<GTT GAA> > gives a match. A better solution is
matching regular expressions is analogous to a walk in the woods, then
the tools discussed in Part 1 are analogous to topo maps and a
compass, basic tools we use all the time. Most of the tools in part 2
-are are analogous to flare guns and satellite phones. They aren't used
+are analogous to flare guns and satellite phones. They aren't used
too often on a hike, but when we are stuck, they can be invaluable.
What follows are the more advanced, less used, or sometimes esoteric
than C<chr(127)> may be represented using the C<\x{hex}> notation,
with C<hex> a hexadecimal integer:
- use utf8; # We will be doing Unicode processing
/\x{263a}/; # match a Unicode smiley face :)
Unicode characters in the range of 128-255 use two hexadecimal digits
with braces: C<\x{ab}>. Note that this is different than C<\xab>,
-which is just a hexadecimal byte with no Unicode
-significance.
+which is just a hexadecimal byte with no Unicode significance.
+
+B<NOTE>: in Perl 5.6.0 it used to be that one needed to say C<use
+utf8> to use any Unicode features. This is no more the case: for
+almost all Unicode processing, the explicit C<utf8> pragma is not
+needed. (The only case where it matters is if your Perl script is in
+Unicode and encoded in UTF-8, then an explicit C<use utf8> is needed.)
Figuring out the hexadecimal sequence of a Unicode character you want
or deciphering someone else's hexadecimal Unicode regexp is about as
represent or match the astrological sign for the planet Mercury, we
could use
- use utf8; # We will be doing Unicode processing
use charnames ":full"; # use named chars with Unicode full names
$x = "abc\N{MERCURY}def";
$x =~ /\N{MERCURY}/; # matches
One can also use short names or restrict names to a certain alphabet:
- use utf8; # We will be doing Unicode processing
-
use charnames ':full';
print "\N{GREEK SMALL LETTER SIGMA} is called sigma.\n";
print "\N{sigma} is Greek sigma\n";
A list of full names is found in the file Names.txt in the
-lib/perl5/5.6.0/unicode directory.
+lib/perl5/5.X.X/unicore directory.
The answer to requirement 2), as of 5.6.0, is that if a regexp
contains Unicode characters, the string is searched as a sequence of
escape sequence. C<\C> is a character class akin to C<.> except that
it matches I<any> byte 0-255. So
- use utf8; # We will be doing Unicode processing
use charnames ":full"; # use named chars with Unicode full names
$x = "a";
$x =~ /\C/; # matches 'a', eats one byte
C<\p{name}> class. For example, to match lower and uppercase
characters,
- use utf8; # We will be doing Unicode processing
use charnames ":full"; # use named chars with Unicode full names
$x = "BOB";
$x =~ /^\p{IsUpper}/; # matches, uppercase char class
IsPrint /^([LMNPS]|Co|Zs)/
IsPunct /^P/
IsSpace /^Z/ || ($code =~ /^(0009|000A|000B|000C|000D)$/
- IsSpacePerl /^Z/ || ($code =~ /^(0009|000A|000C|000D)$/
+ IsSpacePerl /^Z/ || ($code =~ /^(0009|000A|000C|000D|0085|2028|2029)$/
IsUpper /^L[ut]/
IsWord /^[LMN]/ || $code eq "005F"
IsXDigit $code =~ /^00(3[0-9]|[46][1-6])$/
character class of Unicode 'marks', for example accent marks.
For the full list see L<perlunicode>.
-The Unicode has also been separated into blocks of charaters which you
-can test with C<\p{In...}> (in) and C<\P{In...}> (not in), for example
-C<\p{InLatin}, C<\p{InGreek}>, or C<\P{InKatakana}>. For the full list see
-L<perlunicode>.
-
-For the the full and latest information see the latest Unicode standard.
+The Unicode has also been separated into various sets of charaters
+which you can test with C<\p{In...}> (in) and C<\P{In...}> (not in),
+for example C<\p{Latin}>, C<\p{Greek}>, or C<\P{Katakana}>.
+For the full list see L<perlunicode>.
C<\X> is an abbreviation for a character class sequence that includes
the Unicode 'combining character sequences'. A 'combining character
atop it, as in the word Angstrom. C<\X> is equivalent to C<\PM\pM*}>,
i.e., a non-mark followed by one or more marks.
+For the full and latest information about Unicode see the latest
+Unicode standard, or the Unicode Consortium's website http://www.unicode.org/
+
As if all those classes weren't enough, Perl also defines POSIX style
character classes. These have the form C<[:name:]>, with C<name> the
name of the POSIX class. The POSIX classes are C<alpha>, C<alnum>,
character classes. To negate a POSIX class, put a C<^> in front of
the name, so that, e.g., C<[:^digit:]> corresponds to C<\D> and under
C<utf8>, C<\P{IsDigit}>. The Unicode and POSIX character classes can
-be used just like C<\d>, both inside and outside of character classes:
+be used just like C<\d>, with the exception that POSIX character
+classes can only be used inside of a character class:
/\s+[abc[:digit:]xyz]\s*/; # match a,b,c,x,y,z, or a digit
- /^=item\s[:digit:]/; # match '=item',
+ /^=item\s[[:digit:]]/; # match '=item',
# followed by a space and a digit
- use utf8;
use charnames ":full";
/\s+[abc\p{IsDigit}xyz]\s+/; # match a,b,c,x,y,z, or a digit
/^=item\s\p{IsDigit}/; # match '=item',
The independent subexpression C<< (?>a*) >> doesn't care about the rest
of the regexp, so it sees an C<a> and grabs it. Then the rest of the
regexp C<ab> cannot match. Because C<< (?>a*) >> is independent, there
-is no backtracking and and the independent subexpression does not give
+is no backtracking and the independent subexpression does not give
up its C<a>. Thus the match of the regexp as a whole fails. A similar
behavior occurs with completely independent regexps:
parentheses and the second alternative C<\([^()]*\)> matching a
substring delimited by parentheses. The problem with this regexp is
that it is pathological: it has nested indeterminate quantifiers
- of the form C<(a+|b)+>. We discussed in Part 1 how nested quantifiers
+of the form C<(a+|b)+>. We discussed in Part 1 how nested quantifiers
like this could take an exponentially long time to execute if there
was no match possible. To prevent the exponential blowup, we need to
prevent useless backtracking at some point. This can be done by
Normally, regexps are a part of Perl expressions.
S<B<Code evaluation> > expressions turn that around by allowing
-arbitrary Perl code to be a part of of a regexp. A code evaluation
+arbitrary Perl code to be a part of a regexp. A code evaluation
expression is denoted C<(?{code})>, with C<code> a string of Perl
statements.