3 perlretut - Perl regular expressions tutorial
7 This page provides a basic tutorial on understanding, creating and
8 using regular expressions in Perl. It serves as a complement to the
9 reference page on regular expressions L<perlre>. Regular expressions
10 are an integral part of the C<m//>, C<s///>, C<qr//> and C<split>
11 operators and so this tutorial also overlaps with
12 L<perlop/"Regexp Quote-Like Operators"> and L<perlfunc/split>.
14 Perl is widely renowned for excellence in text processing, and regular
15 expressions are one of the big factors behind this fame. Perl regular
16 expressions display an efficiency and flexibility unknown in most
17 other computer languages. Mastering even the basics of regular
18 expressions will allow you to manipulate text with surprising ease.
20 What is a regular expression? A regular expression is simply a string
21 that describes a pattern. Patterns are in common use these days;
22 examples are the patterns typed into a search engine to find web pages
23 and the patterns used to list files in a directory, e.g., C<ls *.txt>
24 or C<dir *.*>. In Perl, the patterns described by regular expressions
25 are used to search strings, extract desired parts of strings, and to
26 do search and replace operations.
28 Regular expressions have the undeserved reputation of being abstract
29 and difficult to understand. Regular expressions are constructed using
30 simple concepts like conditionals and loops and are no more difficult
31 to understand than the corresponding C<if> conditionals and C<while>
32 loops in the Perl language itself. In fact, the main challenge in
33 learning regular expressions is just getting used to the terse
34 notation used to express these concepts.
36 This tutorial flattens the learning curve by discussing regular
37 expression concepts, along with their notation, one at a time and with
38 many examples. The first part of the tutorial will progress from the
39 simplest word searches to the basic regular expression concepts. If
40 you master the first part, you will have all the tools needed to solve
41 about 98% of your needs. The second part of the tutorial is for those
42 comfortable with the basics and hungry for more power tools. It
43 discusses the more advanced regular expression operators and
44 introduces the latest cutting edge innovations in 5.6.0.
46 A note: to save time, 'regular expression' is often abbreviated as
47 regexp or regex. Regexp is a more natural abbreviation than regex, but
48 is harder to pronounce. The Perl pod documentation is evenly split on
49 regexp vs regex; in Perl, there is more than one way to abbreviate it.
50 We'll use regexp in this tutorial.
52 =head1 Part 1: The basics
54 =head2 Simple word matching
56 The simplest regexp is simply a word, or more generally, a string of
57 characters. A regexp consisting of a word matches any string that
60 "Hello World" =~ /World/; # matches
62 What is this perl statement all about? C<"Hello World"> is a simple
63 double quoted string. C<World> is the regular expression and the
64 C<//> enclosing C</World/> tells perl to search a string for a match.
65 The operator C<=~> associates the string with the regexp match and
66 produces a true value if the regexp matched, or false if the regexp
67 did not match. In our case, C<World> matches the second word in
68 C<"Hello World">, so the expression is true. Expressions like this
69 are useful in conditionals:
71 if ("Hello World" =~ /World/) {
75 print "It doesn't match\n";
78 There are useful variations on this theme. The sense of the match can
79 be reversed by using C<!~> operator:
81 if ("Hello World" !~ /World/) {
82 print "It doesn't match\n";
88 The literal string in the regexp can be replaced by a variable:
91 if ("Hello World" =~ /$greeting/) {
95 print "It doesn't match\n";
98 If you're matching against the special default variable C<$_>, the
99 C<$_ =~> part can be omitted:
103 print "It matches\n";
106 print "It doesn't match\n";
109 And finally, the C<//> default delimiters for a match can be changed
110 to arbitrary delimiters by putting an C<'m'> out front:
112 "Hello World" =~ m!World!; # matches, delimited by '!'
113 "Hello World" =~ m{World}; # matches, note the matching '{}'
114 "/usr/bin/perl" =~ m"/perl"; # matches after '/usr/bin',
115 # '/' becomes an ordinary char
117 C</World/>, C<m!World!>, and C<m{World}> all represent the
118 same thing. When, e.g., C<""> is used as a delimiter, the forward
119 slash C<'/'> becomes an ordinary character and can be used in a regexp
122 Let's consider how different regexps would match C<"Hello World">:
124 "Hello World" =~ /world/; # doesn't match
125 "Hello World" =~ /o W/; # matches
126 "Hello World" =~ /oW/; # doesn't match
127 "Hello World" =~ /World /; # doesn't match
129 The first regexp C<world> doesn't match because regexps are
130 case-sensitive. The second regexp matches because the substring
131 S<C<'o W'> > occurs in the string S<C<"Hello World"> >. The space
132 character ' ' is treated like any other character in a regexp and is
133 needed to match in this case. The lack of a space character is the
134 reason the third regexp C<'oW'> doesn't match. The fourth regexp
135 C<'World '> doesn't match because there is a space at the end of the
136 regexp, but not at the end of the string. The lesson here is that
137 regexps must match a part of the string I<exactly> in order for the
138 statement to be true.
140 If a regexp matches in more than one place in the string, perl will
141 always match at the earliest possible point in the string:
143 "Hello World" =~ /o/; # matches 'o' in 'Hello'
144 "That hat is red" =~ /hat/; # matches 'hat' in 'That'
146 With respect to character matching, there are a few more points you
147 need to know about. First of all, not all characters can be used 'as
148 is' in a match. Some characters, called B<metacharacters>, are reserved
149 for use in regexp notation. The metacharacters are
153 The significance of each of these will be explained
154 in the rest of the tutorial, but for now, it is important only to know
155 that a metacharacter can be matched by putting a backslash before it:
157 "2+2=4" =~ /2+2/; # doesn't match, + is a metacharacter
158 "2+2=4" =~ /2\+2/; # matches, \+ is treated like an ordinary +
159 "The interval is [0,1)." =~ /[0,1)./ # is a syntax error!
160 "The interval is [0,1)." =~ /\[0,1\)\./ # matches
161 "/usr/bin/perl" =~ /\/usr\/bin\/perl/; # matches
163 In the last regexp, the forward slash C<'/'> is also backslashed,
164 because it is used to delimit the regexp. This can lead to LTS
165 (leaning toothpick syndrome), however, and it is often more readable
166 to change delimiters.
168 "/usr/bin/perl" =~ m!/usr/bin/perl!; # easier to read
170 The backslash character C<'\'> is a metacharacter itself and needs to
173 'C:\WIN32' =~ /C:\\WIN/; # matches
175 In addition to the metacharacters, there are some ASCII characters
176 which don't have printable character equivalents and are instead
177 represented by B<escape sequences>. Common examples are C<\t> for a
178 tab, C<\n> for a newline, C<\r> for a carriage return and C<\a> for a
179 bell. If your string is better thought of as a sequence of arbitrary
180 bytes, the octal escape sequence, e.g., C<\033>, or hexadecimal escape
181 sequence, e.g., C<\x1B> may be a more natural representation for your
182 bytes. Here are some examples of escapes:
184 "1000\t2000" =~ m(0\t2) # matches
185 "1000\n2000" =~ /0\n20/ # matches
186 "1000\t2000" =~ /\000\t2/ # doesn't match, "0" ne "\000"
187 "cat" =~ /\143\x61\x74/ # matches, but a weird way to spell cat
189 If you've been around Perl a while, all this talk of escape sequences
190 may seem familiar. Similar escape sequences are used in double-quoted
191 strings and in fact the regexps in Perl are mostly treated as
192 double-quoted strings. This means that variables can be used in
193 regexps as well. Just like double-quoted strings, the values of the
194 variables in the regexp will be substituted in before the regexp is
195 evaluated for matching purposes. So we have:
198 'housecat' =~ /$foo/; # matches
199 'cathouse' =~ /cat$foo/; # matches
200 'housecat' =~ /${foo}cat/; # matches
202 So far, so good. With the knowledge above you can already perform
203 searches with just about any literal string regexp you can dream up.
204 Here is a I<very simple> emulation of the Unix grep program:
214 % chmod +x simple_grep
216 % simple_grep abba /usr/dict/words
227 This program is easy to understand. C<#!/usr/bin/perl> is the standard
228 way to invoke a perl program from the shell.
229 S<C<$regexp = shift;> > saves the first command line argument as the
230 regexp to be used, leaving the rest of the command line arguments to
231 be treated as files. S<C<< while (<>) >> > loops over all the lines in
232 all the files. For each line, S<C<print if /$regexp/;> > prints the
233 line if the regexp matches the line. In this line, both C<print> and
234 C</$regexp/> use the default variable C<$_> implicitly.
236 With all of the regexps above, if the regexp matched anywhere in the
237 string, it was considered a match. Sometimes, however, we'd like to
238 specify I<where> in the string the regexp should try to match. To do
239 this, we would use the B<anchor> metacharacters C<^> and C<$>. The
240 anchor C<^> means match at the beginning of the string and the anchor
241 C<$> means match at the end of the string, or before a newline at the
242 end of the string. Here is how they are used:
244 "housekeeper" =~ /keeper/; # matches
245 "housekeeper" =~ /^keeper/; # doesn't match
246 "housekeeper" =~ /keeper$/; # matches
247 "housekeeper\n" =~ /keeper$/; # matches
249 The second regexp doesn't match because C<^> constrains C<keeper> to
250 match only at the beginning of the string, but C<"housekeeper"> has
251 keeper starting in the middle. The third regexp does match, since the
252 C<$> constrains C<keeper> to match only at the end of the string.
254 When both C<^> and C<$> are used at the same time, the regexp has to
255 match both the beginning and the end of the string, i.e., the regexp
256 matches the whole string. Consider
258 "keeper" =~ /^keep$/; # doesn't match
259 "keeper" =~ /^keeper$/; # matches
260 "" =~ /^$/; # ^$ matches an empty string
262 The first regexp doesn't match because the string has more to it than
263 C<keep>. Since the second regexp is exactly the string, it
264 matches. Using both C<^> and C<$> in a regexp forces the complete
265 string to match, so it gives you complete control over which strings
266 match and which don't. Suppose you are looking for a fellow named
267 bert, off in a string by himself:
269 "dogbert" =~ /bert/; # matches, but not what you want
271 "dilbert" =~ /^bert/; # doesn't match, but ..
272 "bertram" =~ /^bert/; # matches, so still not good enough
274 "bertram" =~ /^bert$/; # doesn't match, good
275 "dilbert" =~ /^bert$/; # doesn't match, good
276 "bert" =~ /^bert$/; # matches, perfect
278 Of course, in the case of a literal string, one could just as easily
279 use the string equivalence S<C<$string eq 'bert'> > and it would be
280 more efficient. The C<^...$> regexp really becomes useful when we
281 add in the more powerful regexp tools below.
283 =head2 Using character classes
285 Although one can already do quite a lot with the literal string
286 regexps above, we've only scratched the surface of regular expression
287 technology. In this and subsequent sections we will introduce regexp
288 concepts (and associated metacharacter notations) that will allow a
289 regexp to not just represent a single character sequence, but a I<whole
292 One such concept is that of a B<character class>. A character class
293 allows a set of possible characters, rather than just a single
294 character, to match at a particular point in a regexp. Character
295 classes are denoted by brackets C<[...]>, with the set of characters
296 to be possibly matched inside. Here are some examples:
298 /cat/; # matches 'cat'
299 /[bcr]at/; # matches 'bat, 'cat', or 'rat'
300 /item[0123456789]/; # matches 'item0' or ... or 'item9'
301 "abc" =~ /[cab]/; # matches 'a'
303 In the last statement, even though C<'c'> is the first character in
304 the class, C<'a'> matches because the first character position in the
305 string is the earliest point at which the regexp can match.
307 /[yY][eE][sS]/; # match 'yes' in a case-insensitive way
308 # 'yes', 'Yes', 'YES', etc.
310 This regexp displays a common task: perform a case-insensitive
311 match. Perl provides a way of avoiding all those brackets by simply
312 appending an C<'i'> to the end of the match. Then C</[yY][eE][sS]/;>
313 can be rewritten as C</yes/i;>. The C<'i'> stands for
314 case-insensitive and is an example of a B<modifier> of the matching
315 operation. We will meet other modifiers later in the tutorial.
317 We saw in the section above that there were ordinary characters, which
318 represented themselves, and special characters, which needed a
319 backslash C<\> to represent themselves. The same is true in a
320 character class, but the sets of ordinary and special characters
321 inside a character class are different than those outside a character
322 class. The special characters for a character class are C<-]\^$>. C<]>
323 is special because it denotes the end of a character class. C<$> is
324 special because it denotes a scalar variable. C<\> is special because
325 it is used in escape sequences, just like above. Here is how the
326 special characters C<]$\> are handled:
328 /[\]c]def/; # matches ']def' or 'cdef'
330 /[$x]at/; # matches 'bat', 'cat', or 'rat'
331 /[\$x]at/; # matches '$at' or 'xat'
332 /[\\$x]at/; # matches '\at', 'bat, 'cat', or 'rat'
334 The last two are a little tricky. in C<[\$x]>, the backslash protects
335 the dollar sign, so the character class has two members C<$> and C<x>.
336 In C<[\\$x]>, the backslash is protected, so C<$x> is treated as a
337 variable and substituted in double quote fashion.
339 The special character C<'-'> acts as a range operator within character
340 classes, so that a contiguous set of characters can be written as a
341 range. With ranges, the unwieldy C<[0123456789]> and C<[abc...xyz]>
342 become the svelte C<[0-9]> and C<[a-z]>. Some examples are
344 /item[0-9]/; # matches 'item0' or ... or 'item9'
345 /[0-9bx-z]aa/; # matches '0aa', ..., '9aa',
346 # 'baa', 'xaa', 'yaa', or 'zaa'
347 /[0-9a-fA-F]/; # matches a hexadecimal digit
348 /[0-9a-zA-Z_]/; # matches a "word" character,
349 # like those in a perl variable name
351 If C<'-'> is the first or last character in a character class, it is
352 treated as an ordinary character; C<[-ab]>, C<[ab-]> and C<[a\-b]> are
355 The special character C<^> in the first position of a character class
356 denotes a B<negated character class>, which matches any character but
357 those in the brackets. Both C<[...]> and C<[^...]> must match a
358 character, or the match fails. Then
360 /[^a]at/; # doesn't match 'aat' or 'at', but matches
361 # all other 'bat', 'cat, '0at', '%at', etc.
362 /[^0-9]/; # matches a non-numeric character
363 /[a^]at/; # matches 'aat' or '^at'; here '^' is ordinary
365 Now, even C<[0-9]> can be a bother to write multiple times, so in the
366 interest of saving keystrokes and making regexps more readable, Perl
367 has several abbreviations for common character classes:
373 \d is a digit and represents [0-9]
377 \s is a whitespace character and represents [\ \t\r\n\f]
381 \w is a word character (alphanumeric or _) and represents [0-9a-zA-Z_]
385 \D is a negated \d; it represents any character but a digit [^0-9]
389 \S is a negated \s; it represents any non-whitespace character [^\s]
393 \W is a negated \w; it represents any non-word character [^\w]
397 The period '.' matches any character but "\n"
401 The C<\d\s\w\D\S\W> abbreviations can be used both inside and outside
402 of character classes. Here are some in use:
404 /\d\d:\d\d:\d\d/; # matches a hh:mm:ss time format
405 /[\d\s]/; # matches any digit or whitespace character
406 /\w\W\w/; # matches a word char, followed by a
407 # non-word char, followed by a word char
408 /..rt/; # matches any two chars, followed by 'rt'
409 /end\./; # matches 'end.'
410 /end[.]/; # same thing, matches 'end.'
412 Because a period is a metacharacter, it needs to be escaped to match
413 as an ordinary period. Because, for example, C<\d> and C<\w> are sets
414 of characters, it is incorrect to think of C<[^\d\w]> as C<[\D\W]>; in
415 fact C<[^\d\w]> is the same as C<[^\w]>, which is the same as
416 C<[\W]>. Think DeMorgan's laws.
418 An anchor useful in basic regexps is the S<B<word anchor> >
419 C<\b>. This matches a boundary between a word character and a non-word
420 character C<\w\W> or C<\W\w>:
422 $x = "Housecat catenates house and cat";
423 $x =~ /cat/; # matches cat in 'housecat'
424 $x =~ /\bcat/; # matches cat in 'catenates'
425 $x =~ /cat\b/; # matches cat in 'housecat'
426 $x =~ /\bcat\b/; # matches 'cat' at end of string
428 Note in the last example, the end of the string is considered a word
431 You might wonder why C<'.'> matches everything but C<"\n"> - why not
432 every character? The reason is that often one is matching against
433 lines and would like to ignore the newline characters. For instance,
434 while the string C<"\n"> represents one line, we would like to think
437 "" =~ /^$/; # matches
438 "\n" =~ /^$/; # matches, "\n" is ignored
440 "" =~ /./; # doesn't match; it needs a char
441 "" =~ /^.$/; # doesn't match; it needs a char
442 "\n" =~ /^.$/; # doesn't match; it needs a char other than "\n"
443 "a" =~ /^.$/; # matches
444 "a\n" =~ /^.$/; # matches, ignores the "\n"
446 This behavior is convenient, because we usually want to ignore
447 newlines when we count and match characters in a line. Sometimes,
448 however, we want to keep track of newlines. We might even want C<^>
449 and C<$> to anchor at the beginning and end of lines within the
450 string, rather than just the beginning and end of the string. Perl
451 allows us to choose between ignoring and paying attention to newlines
452 by using the C<//s> and C<//m> modifiers. C<//s> and C<//m> stand for
453 single line and multi-line and they determine whether a string is to
454 be treated as one continuous string, or as a set of lines. The two
455 modifiers affect two aspects of how the regexp is interpreted: 1) how
456 the C<'.'> character class is defined, and 2) where the anchors C<^>
457 and C<$> are able to match. Here are the four possible combinations:
463 no modifiers (//): Default behavior. C<'.'> matches any character
464 except C<"\n">. C<^> matches only at the beginning of the string and
465 C<$> matches only at the end or before a newline at the end.
469 s modifier (//s): Treat string as a single long line. C<'.'> matches
470 any character, even C<"\n">. C<^> matches only at the beginning of
471 the string and C<$> matches only at the end or before a newline at the
476 m modifier (//m): Treat string as a set of multiple lines. C<'.'>
477 matches any character except C<"\n">. C<^> and C<$> are able to match
478 at the start or end of I<any> line within the string.
482 both s and m modifiers (//sm): Treat string as a single long line, but
483 detect multiple lines. C<'.'> matches any character, even
484 C<"\n">. C<^> and C<$>, however, are able to match at the start or end
485 of I<any> line within the string.
489 Here are examples of C<//s> and C<//m> in action:
491 $x = "There once was a girl\nWho programmed in Perl\n";
493 $x =~ /^Who/; # doesn't match, "Who" not at start of string
494 $x =~ /^Who/s; # doesn't match, "Who" not at start of string
495 $x =~ /^Who/m; # matches, "Who" at start of second line
496 $x =~ /^Who/sm; # matches, "Who" at start of second line
498 $x =~ /girl.Who/; # doesn't match, "." doesn't match "\n"
499 $x =~ /girl.Who/s; # matches, "." matches "\n"
500 $x =~ /girl.Who/m; # doesn't match, "." doesn't match "\n"
501 $x =~ /girl.Who/sm; # matches, "." matches "\n"
503 Most of the time, the default behavior is what is wanted, but C<//s> and
504 C<//m> are occasionally very useful. If C<//m> is being used, the start
505 of the string can still be matched with C<\A> and the end of the string
506 can still be matched with the anchors C<\Z> (matches both the end and
507 the newline before, like C<$>), and C<\z> (matches only the end):
509 $x =~ /^Who/m; # matches, "Who" at start of second line
510 $x =~ /\AWho/m; # doesn't match, "Who" is not at start of string
512 $x =~ /girl$/m; # matches, "girl" at end of first line
513 $x =~ /girl\Z/m; # doesn't match, "girl" is not at end of string
515 $x =~ /Perl\Z/m; # matches, "Perl" is at newline before end
516 $x =~ /Perl\z/m; # doesn't match, "Perl" is not at end of string
518 We now know how to create choices among classes of characters in a
519 regexp. What about choices among words or character strings? Such
520 choices are described in the next section.
522 =head2 Matching this or that
524 Sometimes we would like our regexp to be able to match different
525 possible words or character strings. This is accomplished by using
526 the B<alternation> metacharacter C<|>. To match C<dog> or C<cat>, we
527 form the regexp C<dog|cat>. As before, perl will try to match the
528 regexp at the earliest possible point in the string. At each
529 character position, perl will first try to match the first
530 alternative, C<dog>. If C<dog> doesn't match, perl will then try the
531 next alternative, C<cat>. If C<cat> doesn't match either, then the
532 match fails and perl moves to the next position in the string. Some
535 "cats and dogs" =~ /cat|dog|bird/; # matches "cat"
536 "cats and dogs" =~ /dog|cat|bird/; # matches "cat"
538 Even though C<dog> is the first alternative in the second regexp,
539 C<cat> is able to match earlier in the string.
541 "cats" =~ /c|ca|cat|cats/; # matches "c"
542 "cats" =~ /cats|cat|ca|c/; # matches "cats"
544 Here, all the alternatives match at the first string position, so the
545 first alternative is the one that matches. If some of the
546 alternatives are truncations of the others, put the longest ones first
547 to give them a chance to match.
549 "cab" =~ /a|b|c/ # matches "c"
552 The last example points out that character classes are like
553 alternations of characters. At a given character position, the first
554 alternative that allows the regexp match to succeed will be the one
557 =head2 Grouping things and hierarchical matching
559 Alternation allows a regexp to choose among alternatives, but by
560 itself it unsatisfying. The reason is that each alternative is a whole
561 regexp, but sometime we want alternatives for just part of a
562 regexp. For instance, suppose we want to search for housecats or
563 housekeepers. The regexp C<housecat|housekeeper> fits the bill, but is
564 inefficient because we had to type C<house> twice. It would be nice to
565 have parts of the regexp be constant, like C<house>, and some
566 parts have alternatives, like C<cat|keeper>.
568 The B<grouping> metacharacters C<()> solve this problem. Grouping
569 allows parts of a regexp to be treated as a single unit. Parts of a
570 regexp are grouped by enclosing them in parentheses. Thus we could solve
571 the C<housecat|housekeeper> by forming the regexp as
572 C<house(cat|keeper)>. The regexp C<house(cat|keeper)> means match
573 C<house> followed by either C<cat> or C<keeper>. Some more examples
576 /(a|b)b/; # matches 'ab' or 'bb'
577 /(ac|b)b/; # matches 'acb' or 'bb'
578 /(^a|b)c/; # matches 'ac' at start of string or 'bc' anywhere
579 /(a|[bc])d/; # matches 'ad', 'bd', or 'cd'
581 /house(cat|)/; # matches either 'housecat' or 'house'
582 /house(cat(s|)|)/; # matches either 'housecats' or 'housecat' or
583 # 'house'. Note groups can be nested.
585 /(19|20|)\d\d/; # match years 19xx, 20xx, or the Y2K problem, xx
586 "20" =~ /(19|20|)\d\d/; # matches the null alternative '()\d\d',
587 # because '20\d\d' can't match
589 Alternations behave the same way in groups as out of them: at a given
590 string position, the leftmost alternative that allows the regexp to
591 match is taken. So in the last example at the first string position,
592 C<"20"> matches the second alternative, but there is nothing left over
593 to match the next two digits C<\d\d>. So perl moves on to the next
594 alternative, which is the null alternative and that works, since
595 C<"20"> is two digits.
597 The process of trying one alternative, seeing if it matches, and
598 moving on to the next alternative if it doesn't, is called
599 B<backtracking>. The term 'backtracking' comes from the idea that
600 matching a regexp is like a walk in the woods. Successfully matching
601 a regexp is like arriving at a destination. There are many possible
602 trailheads, one for each string position, and each one is tried in
603 order, left to right. From each trailhead there may be many paths,
604 some of which get you there, and some which are dead ends. When you
605 walk along a trail and hit a dead end, you have to backtrack along the
606 trail to an earlier point to try another trail. If you hit your
607 destination, you stop immediately and forget about trying all the
608 other trails. You are persistent, and only if you have tried all the
609 trails from all the trailheads and not arrived at your destination, do
610 you declare failure. To be concrete, here is a step-by-step analysis
611 of what perl does when it tries to match the regexp
613 "abcde" =~ /(abd|abc)(df|d|de)/;
619 Start with the first letter in the string 'a'.
623 Try the first alternative in the first group 'abd'.
627 Match 'a' followed by 'b'. So far so good.
631 'd' in the regexp doesn't match 'c' in the string - a dead
632 end. So backtrack two characters and pick the second alternative in
633 the first group 'abc'.
637 Match 'a' followed by 'b' followed by 'c'. We are on a roll
638 and have satisfied the first group. Set $1 to 'abc'.
642 Move on to the second group and pick the first alternative
651 'f' in the regexp doesn't match 'e' in the string, so a dead
652 end. Backtrack one character and pick the second alternative in the
657 'd' matches. The second grouping is satisfied, so set $2 to
662 We are at the end of the regexp, so we are done! We have
663 matched 'abcd' out of the string "abcde".
667 There are a couple of things to note about this analysis. First, the
668 third alternative in the second group 'de' also allows a match, but we
669 stopped before we got to it - at a given character position, leftmost
670 wins. Second, we were able to get a match at the first character
671 position of the string 'a'. If there were no matches at the first
672 position, perl would move to the second character position 'b' and
673 attempt the match all over again. Only when all possible paths at all
674 possible character positions have been exhausted does perl give
675 up and declare S<C<$string =~ /(abd|abc)(df|d|de)/;> > to be false.
677 Even with all this work, regexp matching happens remarkably fast. To
678 speed things up, during compilation stage, perl compiles the regexp
679 into a compact sequence of opcodes that can often fit inside a
680 processor cache. When the code is executed, these opcodes can then run
681 at full throttle and search very quickly.
683 =head2 Extracting matches
685 The grouping metacharacters C<()> also serve another completely
686 different function: they allow the extraction of the parts of a string
687 that matched. This is very useful to find out what matched and for
688 text processing in general. For each grouping, the part that matched
689 inside goes into the special variables C<$1>, C<$2>, etc. They can be
690 used just as ordinary variables:
692 # extract hours, minutes, seconds
693 if ($time =~ /(\d\d):(\d\d):(\d\d)/) { # match hh:mm:ss format
699 Now, we know that in scalar context,
700 S<C<$time =~ /(\d\d):(\d\d):(\d\d)/> > returns a true or false
701 value. In list context, however, it returns the list of matched values
702 C<($1,$2,$3)>. So we could write the code more compactly as
704 # extract hours, minutes, seconds
705 ($hours, $minutes, $second) = ($time =~ /(\d\d):(\d\d):(\d\d)/);
707 If the groupings in a regexp are nested, C<$1> gets the group with the
708 leftmost opening parenthesis, C<$2> the next opening parenthesis,
709 etc. For example, here is a complex regexp and the matching variables
712 /(ab(cd|ef)((gi)|j))/;
715 so that if the regexp matched, e.g., C<$2> would contain 'cd' or 'ef'. For
716 convenience, perl sets C<$+> to the string held by the highest numbered
717 C<$1>, C<$2>, ... that got assigned (and, somewhat related, C<$^N> to the
718 value of the C<$1>, C<$2>, ... most-recently assigned; i.e. the C<$1>,
719 C<$2>, ... associated with the rightmost closing parenthesis used in the
722 Closely associated with the matching variables C<$1>, C<$2>, ... are
723 the B<backreferences> C<\1>, C<\2>, ... . Backreferences are simply
724 matching variables that can be used I<inside> a regexp. This is a
725 really nice feature - what matches later in a regexp can depend on
726 what matched earlier in the regexp. Suppose we wanted to look
727 for doubled words in text, like 'the the'. The following regexp finds
728 all 3-letter doubles with a space in between:
732 The grouping assigns a value to \1, so that the same 3 letter sequence
733 is used for both parts. Here are some words with repeated parts:
735 % simple_grep '^(\w\w\w\w|\w\w\w|\w\w|\w)\1$' /usr/dict/words
743 The regexp has a single grouping which considers 4-letter
744 combinations, then 3-letter combinations, etc. and uses C<\1> to look for
745 a repeat. Although C<$1> and C<\1> represent the same thing, care should be
746 taken to use matched variables C<$1>, C<$2>, ... only outside a regexp
747 and backreferences C<\1>, C<\2>, ... only inside a regexp; not doing
748 so may lead to surprising and/or undefined results.
750 In addition to what was matched, Perl 5.6.0 also provides the
751 positions of what was matched with the C<@-> and C<@+>
752 arrays. C<$-[0]> is the position of the start of the entire match and
753 C<$+[0]> is the position of the end. Similarly, C<$-[n]> is the
754 position of the start of the C<$n> match and C<$+[n]> is the position
755 of the end. If C<$n> is undefined, so are C<$-[n]> and C<$+[n]>. Then
758 $x = "Mmm...donut, thought Homer";
759 $x =~ /^(Mmm|Yech)\.\.\.(donut|peas)/; # matches
760 foreach $expr (1..$#-) {
761 print "Match $expr: '${$expr}' at position ($-[$expr],$+[$expr])\n";
766 Match 1: 'Mmm' at position (0,3)
767 Match 2: 'donut' at position (6,11)
769 Even if there are no groupings in a regexp, it is still possible to
770 find out what exactly matched in a string. If you use them, perl
771 will set C<$`> to the part of the string before the match, will set C<$&>
772 to the part of the string that matched, and will set C<$'> to the part
773 of the string after the match. An example:
775 $x = "the cat caught the mouse";
776 $x =~ /cat/; # $` = 'the ', $& = 'cat', $' = ' caught the mouse'
777 $x =~ /the/; # $` = '', $& = 'the', $' = ' cat caught the mouse'
779 In the second match, S<C<$` = ''> > because the regexp matched at the
780 first character position in the string and stopped, it never saw the
781 second 'the'. It is important to note that using C<$`> and C<$'>
782 slows down regexp matching quite a bit, and C< $& > slows it down to a
783 lesser extent, because if they are used in one regexp in a program,
784 they are generated for <all> regexps in the program. So if raw
785 performance is a goal of your application, they should be avoided.
786 If you need them, use C<@-> and C<@+> instead:
788 $` is the same as substr( $x, 0, $-[0] )
789 $& is the same as substr( $x, $-[0], $+[0]-$-[0] )
790 $' is the same as substr( $x, $+[0] )
792 =head2 Matching repetitions
794 The examples in the previous section display an annoying weakness. We
795 were only matching 3-letter words, or syllables of 4 letters or
796 less. We'd like to be able to match words or syllables of any length,
797 without writing out tedious alternatives like
798 C<\w\w\w\w|\w\w\w|\w\w|\w>.
800 This is exactly the problem the B<quantifier> metacharacters C<?>,
801 C<*>, C<+>, and C<{}> were created for. They allow us to determine the
802 number of repeats of a portion of a regexp we consider to be a
803 match. Quantifiers are put immediately after the character, character
804 class, or grouping that we want to specify. They have the following
811 C<a?> = match 'a' 1 or 0 times
815 C<a*> = match 'a' 0 or more times, i.e., any number of times
819 C<a+> = match 'a' 1 or more times, i.e., at least once
823 C<a{n,m}> = match at least C<n> times, but not more than C<m>
828 C<a{n,}> = match at least C<n> or more times
832 C<a{n}> = match exactly C<n> times
836 Here are some examples:
838 /[a-z]+\s+\d*/; # match a lowercase word, at least some space, and
839 # any number of digits
840 /(\w+)\s+\1/; # match doubled words of arbitrary length
841 /y(es)?/i; # matches 'y', 'Y', or a case-insensitive 'yes'
842 $year =~ /\d{2,4}/; # make sure year is at least 2 but not more
844 $year =~ /\d{4}|\d{2}/; # better match; throw out 3 digit dates
845 $year =~ /\d{2}(\d{2})?/; # same thing written differently. However,
846 # this produces $1 and the other does not.
848 % simple_grep '^(\w+)\1$' /usr/dict/words # isn't this easier?
856 For all of these quantifiers, perl will try to match as much of the
857 string as possible, while still allowing the regexp to succeed. Thus
858 with C</a?.../>, perl will first try to match the regexp with the C<a>
859 present; if that fails, perl will try to match the regexp without the
860 C<a> present. For the quantifier C<*>, we get the following:
862 $x = "the cat in the hat";
863 $x =~ /^(.*)(cat)(.*)$/; # matches,
868 Which is what we might expect, the match finds the only C<cat> in the
869 string and locks onto it. Consider, however, this regexp:
871 $x =~ /^(.*)(at)(.*)$/; # matches,
872 # $1 = 'the cat in the h'
874 # $3 = '' (0 matches)
876 One might initially guess that perl would find the C<at> in C<cat> and
877 stop there, but that wouldn't give the longest possible string to the
878 first quantifier C<.*>. Instead, the first quantifier C<.*> grabs as
879 much of the string as possible while still having the regexp match. In
880 this example, that means having the C<at> sequence with the final C<at>
881 in the string. The other important principle illustrated here is that
882 when there are two or more elements in a regexp, the I<leftmost>
883 quantifier, if there is one, gets to grab as much the string as
884 possible, leaving the rest of the regexp to fight over scraps. Thus in
885 our example, the first quantifier C<.*> grabs most of the string, while
886 the second quantifier C<.*> gets the empty string. Quantifiers that
887 grab as much of the string as possible are called B<maximal match> or
888 B<greedy> quantifiers.
890 When a regexp can match a string in several different ways, we can use
891 the principles above to predict which way the regexp will match:
897 Principle 0: Taken as a whole, any regexp will be matched at the
898 earliest possible position in the string.
902 Principle 1: In an alternation C<a|b|c...>, the leftmost alternative
903 that allows a match for the whole regexp will be the one used.
907 Principle 2: The maximal matching quantifiers C<?>, C<*>, C<+> and
908 C<{n,m}> will in general match as much of the string as possible while
909 still allowing the whole regexp to match.
913 Principle 3: If there are two or more elements in a regexp, the
914 leftmost greedy quantifier, if any, will match as much of the string
915 as possible while still allowing the whole regexp to match. The next
916 leftmost greedy quantifier, if any, will try to match as much of the
917 string remaining available to it as possible, while still allowing the
918 whole regexp to match. And so on, until all the regexp elements are
923 As we have seen above, Principle 0 overrides the others - the regexp
924 will be matched as early as possible, with the other principles
925 determining how the regexp matches at that earliest character
928 Here is an example of these principles in action:
930 $x = "The programming republic of Perl";
931 $x =~ /^(.+)(e|r)(.*)$/; # matches,
932 # $1 = 'The programming republic of Pe'
936 This regexp matches at the earliest string position, C<'T'>. One
937 might think that C<e>, being leftmost in the alternation, would be
938 matched, but C<r> produces the longest string in the first quantifier.
940 $x =~ /(m{1,2})(.*)$/; # matches,
942 # $2 = 'ing republic of Perl'
944 Here, The earliest possible match is at the first C<'m'> in
945 C<programming>. C<m{1,2}> is the first quantifier, so it gets to match
948 $x =~ /.*(m{1,2})(.*)$/; # matches,
950 # $2 = 'ing republic of Perl'
952 Here, the regexp matches at the start of the string. The first
953 quantifier C<.*> grabs as much as possible, leaving just a single
954 C<'m'> for the second quantifier C<m{1,2}>.
956 $x =~ /(.?)(m{1,2})(.*)$/; # matches,
959 # $3 = 'ing republic of Perl'
961 Here, C<.?> eats its maximal one character at the earliest possible
962 position in the string, C<'a'> in C<programming>, leaving C<m{1,2}>
963 the opportunity to match both C<m>'s. Finally,
965 "aXXXb" =~ /(X*)/; # matches with $1 = ''
967 because it can match zero copies of C<'X'> at the beginning of the
968 string. If you definitely want to match at least one C<'X'>, use
971 Sometimes greed is not good. At times, we would like quantifiers to
972 match a I<minimal> piece of string, rather than a maximal piece. For
973 this purpose, Larry Wall created the S<B<minimal match> > or
974 B<non-greedy> quantifiers C<??>,C<*?>, C<+?>, and C<{}?>. These are
975 the usual quantifiers with a C<?> appended to them. They have the
982 C<a??> = match 'a' 0 or 1 times. Try 0 first, then 1.
986 C<a*?> = match 'a' 0 or more times, i.e., any number of times,
987 but as few times as possible
991 C<a+?> = match 'a' 1 or more times, i.e., at least once, but
992 as few times as possible
996 C<a{n,m}?> = match at least C<n> times, not more than C<m>
997 times, as few times as possible
1001 C<a{n,}?> = match at least C<n> times, but as few times as
1006 C<a{n}?> = match exactly C<n> times. Because we match exactly
1007 C<n> times, C<a{n}?> is equivalent to C<a{n}> and is just there for
1008 notational consistency.
1012 Let's look at the example above, but with minimal quantifiers:
1014 $x = "The programming republic of Perl";
1015 $x =~ /^(.+?)(e|r)(.*)$/; # matches,
1018 # $3 = ' programming republic of Perl'
1020 The minimal string that will allow both the start of the string C<^>
1021 and the alternation to match is C<Th>, with the alternation C<e|r>
1022 matching C<e>. The second quantifier C<.*> is free to gobble up the
1025 $x =~ /(m{1,2}?)(.*?)$/; # matches,
1027 # $2 = 'ming republic of Perl'
1029 The first string position that this regexp can match is at the first
1030 C<'m'> in C<programming>. At this position, the minimal C<m{1,2}?>
1031 matches just one C<'m'>. Although the second quantifier C<.*?> would
1032 prefer to match no characters, it is constrained by the end-of-string
1033 anchor C<$> to match the rest of the string.
1035 $x =~ /(.*?)(m{1,2}?)(.*)$/; # matches,
1038 # $3 = 'ming republic of Perl'
1040 In this regexp, you might expect the first minimal quantifier C<.*?>
1041 to match the empty string, because it is not constrained by a C<^>
1042 anchor to match the beginning of the word. Principle 0 applies here,
1043 however. Because it is possible for the whole regexp to match at the
1044 start of the string, it I<will> match at the start of the string. Thus
1045 the first quantifier has to match everything up to the first C<m>. The
1046 second minimal quantifier matches just one C<m> and the third
1047 quantifier matches the rest of the string.
1049 $x =~ /(.??)(m{1,2})(.*)$/; # matches,
1052 # $3 = 'ing republic of Perl'
1054 Just as in the previous regexp, the first quantifier C<.??> can match
1055 earliest at position C<'a'>, so it does. The second quantifier is
1056 greedy, so it matches C<mm>, and the third matches the rest of the
1059 We can modify principle 3 above to take into account non-greedy
1066 Principle 3: If there are two or more elements in a regexp, the
1067 leftmost greedy (non-greedy) quantifier, if any, will match as much
1068 (little) of the string as possible while still allowing the whole
1069 regexp to match. The next leftmost greedy (non-greedy) quantifier, if
1070 any, will try to match as much (little) of the string remaining
1071 available to it as possible, while still allowing the whole regexp to
1072 match. And so on, until all the regexp elements are satisfied.
1076 Just like alternation, quantifiers are also susceptible to
1077 backtracking. Here is a step-by-step analysis of the example
1079 $x = "the cat in the hat";
1080 $x =~ /^(.*)(at)(.*)$/; # matches,
1081 # $1 = 'the cat in the h'
1083 # $3 = '' (0 matches)
1089 Start with the first letter in the string 't'.
1093 The first quantifier '.*' starts out by matching the whole
1094 string 'the cat in the hat'.
1098 'a' in the regexp element 'at' doesn't match the end of the
1099 string. Backtrack one character.
1103 'a' in the regexp element 'at' still doesn't match the last
1104 letter of the string 't', so backtrack one more character.
1108 Now we can match the 'a' and the 't'.
1112 Move on to the third element '.*'. Since we are at the end of
1113 the string and '.*' can match 0 times, assign it the empty string.
1121 Most of the time, all this moving forward and backtracking happens
1122 quickly and searching is fast. There are some pathological regexps,
1123 however, whose execution time exponentially grows with the size of the
1124 string. A typical structure that blows up in your face is of the form
1128 The problem is the nested indeterminate quantifiers. There are many
1129 different ways of partitioning a string of length n between the C<+>
1130 and C<*>: one repetition with C<b+> of length n, two repetitions with
1131 the first C<b+> length k and the second with length n-k, m repetitions
1132 whose bits add up to length n, etc. In fact there are an exponential
1133 number of ways to partition a string as a function of length. A
1134 regexp may get lucky and match early in the process, but if there is
1135 no match, perl will try I<every> possibility before giving up. So be
1136 careful with nested C<*>'s, C<{n,m}>'s, and C<+>'s. The book
1137 I<Mastering regular expressions> by Jeffrey Friedl gives a wonderful
1138 discussion of this and other efficiency issues.
1140 =head2 Building a regexp
1142 At this point, we have all the basic regexp concepts covered, so let's
1143 give a more involved example of a regular expression. We will build a
1144 regexp that matches numbers.
1146 The first task in building a regexp is to decide what we want to match
1147 and what we want to exclude. In our case, we want to match both
1148 integers and floating point numbers and we want to reject any string
1149 that isn't a number.
1151 The next task is to break the problem down into smaller problems that
1152 are easily converted into a regexp.
1154 The simplest case is integers. These consist of a sequence of digits,
1155 with an optional sign in front. The digits we can represent with
1156 C<\d+> and the sign can be matched with C<[+-]>. Thus the integer
1159 /[+-]?\d+/; # matches integers
1161 A floating point number potentially has a sign, an integral part, a
1162 decimal point, a fractional part, and an exponent. One or more of these
1163 parts is optional, so we need to check out the different
1164 possibilities. Floating point numbers which are in proper form include
1165 123., 0.345, .34, -1e6, and 25.4E-72. As with integers, the sign out
1166 front is completely optional and can be matched by C<[+-]?>. We can
1167 see that if there is no exponent, floating point numbers must have a
1168 decimal point, otherwise they are integers. We might be tempted to
1169 model these with C<\d*\.\d*>, but this would also match just a single
1170 decimal point, which is not a number. So the three cases of floating
1171 point number sans exponent are
1173 /[+-]?\d+\./; # 1., 321., etc.
1174 /[+-]?\.\d+/; # .1, .234, etc.
1175 /[+-]?\d+\.\d+/; # 1.0, 30.56, etc.
1177 These can be combined into a single regexp with a three-way alternation:
1179 /[+-]?(\d+\.\d+|\d+\.|\.\d+)/; # floating point, no exponent
1181 In this alternation, it is important to put C<'\d+\.\d+'> before
1182 C<'\d+\.'>. If C<'\d+\.'> were first, the regexp would happily match that
1183 and ignore the fractional part of the number.
1185 Now consider floating point numbers with exponents. The key
1186 observation here is that I<both> integers and numbers with decimal
1187 points are allowed in front of an exponent. Then exponents, like the
1188 overall sign, are independent of whether we are matching numbers with
1189 or without decimal points, and can be 'decoupled' from the
1190 mantissa. The overall form of the regexp now becomes clear:
1192 /^(optional sign)(integer | f.p. mantissa)(optional exponent)$/;
1194 The exponent is an C<e> or C<E>, followed by an integer. So the
1197 /[eE][+-]?\d+/; # exponent
1199 Putting all the parts together, we get a regexp that matches numbers:
1201 /^[+-]?(\d+\.\d+|\d+\.|\.\d+|\d+)([eE][+-]?\d+)?$/; # Ta da!
1203 Long regexps like this may impress your friends, but can be hard to
1204 decipher. In complex situations like this, the C<//x> modifier for a
1205 match is invaluable. It allows one to put nearly arbitrary whitespace
1206 and comments into a regexp without affecting their meaning. Using it,
1207 we can rewrite our 'extended' regexp in the more pleasing form
1210 [+-]? # first, match an optional sign
1211 ( # then match integers or f.p. mantissas:
1212 \d+\.\d+ # mantissa of the form a.b
1213 |\d+\. # mantissa of the form a.
1214 |\.\d+ # mantissa of the form .b
1215 |\d+ # integer of the form a
1217 ([eE][+-]?\d+)? # finally, optionally match an exponent
1220 If whitespace is mostly irrelevant, how does one include space
1221 characters in an extended regexp? The answer is to backslash it
1222 S<C<'\ '> > or put it in a character class S<C<[ ]> >. The same thing
1223 goes for pound signs, use C<\#> or C<[#]>. For instance, Perl allows
1224 a space between the sign and the mantissa/integer, and we could add
1225 this to our regexp as follows:
1228 [+-]?\ * # first, match an optional sign *and space*
1229 ( # then match integers or f.p. mantissas:
1230 \d+\.\d+ # mantissa of the form a.b
1231 |\d+\. # mantissa of the form a.
1232 |\.\d+ # mantissa of the form .b
1233 |\d+ # integer of the form a
1235 ([eE][+-]?\d+)? # finally, optionally match an exponent
1238 In this form, it is easier to see a way to simplify the
1239 alternation. Alternatives 1, 2, and 4 all start with C<\d+>, so it
1240 could be factored out:
1243 [+-]?\ * # first, match an optional sign
1244 ( # then match integers or f.p. mantissas:
1245 \d+ # start out with a ...
1247 \.\d* # mantissa of the form a.b or a.
1248 )? # ? takes care of integers of the form a
1249 |\.\d+ # mantissa of the form .b
1251 ([eE][+-]?\d+)? # finally, optionally match an exponent
1254 or written in the compact form,
1256 /^[+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?$/;
1258 This is our final regexp. To recap, we built a regexp by
1264 specifying the task in detail,
1268 breaking down the problem into smaller parts,
1272 translating the small parts into regexps,
1276 combining the regexps,
1280 and optimizing the final combined regexp.
1284 These are also the typical steps involved in writing a computer
1285 program. This makes perfect sense, because regular expressions are
1286 essentially programs written a little computer language that specifies
1289 =head2 Using regular expressions in Perl
1291 The last topic of Part 1 briefly covers how regexps are used in Perl
1292 programs. Where do they fit into Perl syntax?
1294 We have already introduced the matching operator in its default
1295 C</regexp/> and arbitrary delimiter C<m!regexp!> forms. We have used
1296 the binding operator C<=~> and its negation C<!~> to test for string
1297 matches. Associated with the matching operator, we have discussed the
1298 single line C<//s>, multi-line C<//m>, case-insensitive C<//i> and
1299 extended C<//x> modifiers.
1301 There are a few more things you might want to know about matching
1302 operators. First, we pointed out earlier that variables in regexps are
1303 substituted before the regexp is evaluated:
1307 print if /$pattern/;
1310 This will print any lines containing the word C<Seuss>. It is not as
1311 efficient as it could be, however, because perl has to re-evaluate
1312 C<$pattern> each time through the loop. If C<$pattern> won't be
1313 changing over the lifetime of the script, we can add the C<//o>
1314 modifier, which directs perl to only perform variable substitutions
1318 # Improved simple_grep
1321 print if /$regexp/o; # a good deal faster
1324 If you change C<$pattern> after the first substitution happens, perl
1325 will ignore it. If you don't want any substitutions at all, use the
1326 special delimiter C<m''>:
1328 @pattern = ('Seuss');
1330 print if m'@pattern'; # matches literal '@pattern', not 'Seuss'
1333 C<m''> acts like single quotes on a regexp; all other C<m> delimiters
1334 act like double quotes. If the regexp evaluates to the empty string,
1335 the regexp in the I<last successful match> is used instead. So we have
1337 "dog" =~ /d/; # 'd' matches
1338 "dogbert =~ //; # this matches the 'd' regexp used before
1340 The final two modifiers C<//g> and C<//c> concern multiple matches.
1341 The modifier C<//g> stands for global matching and allows the
1342 matching operator to match within a string as many times as possible.
1343 In scalar context, successive invocations against a string will have
1344 `C<//g> jump from match to match, keeping track of position in the
1345 string as it goes along. You can get or set the position with the
1348 The use of C<//g> is shown in the following example. Suppose we have
1349 a string that consists of words separated by spaces. If we know how
1350 many words there are in advance, we could extract the words using
1353 $x = "cat dog house"; # 3 words
1354 $x =~ /^\s*(\w+)\s+(\w+)\s+(\w+)\s*$/; # matches,
1359 But what if we had an indeterminate number of words? This is the sort
1360 of task C<//g> was made for. To extract all words, form the simple
1361 regexp C<(\w+)> and loop over all matches with C</(\w+)/g>:
1363 while ($x =~ /(\w+)/g) {
1364 print "Word is $1, ends at position ", pos $x, "\n";
1369 Word is cat, ends at position 3
1370 Word is dog, ends at position 7
1371 Word is house, ends at position 13
1373 A failed match or changing the target string resets the position. If
1374 you don't want the position reset after failure to match, add the
1375 C<//c>, as in C</regexp/gc>. The current position in the string is
1376 associated with the string, not the regexp. This means that different
1377 strings have different positions and their respective positions can be
1378 set or read independently.
1380 In list context, C<//g> returns a list of matched groupings, or if
1381 there are no groupings, a list of matches to the whole regexp. So if
1382 we wanted just the words, we could use
1384 @words = ($x =~ /(\w+)/g); # matches,
1387 # $word[2] = 'house'
1389 Closely associated with the C<//g> modifier is the C<\G> anchor. The
1390 C<\G> anchor matches at the point where the previous C<//g> match left
1391 off. C<\G> allows us to easily do context-sensitive matching:
1393 $metric = 1; # use metric units
1395 $x = <FILE>; # read in measurement
1396 $x =~ /^([+-]?\d+)\s*/g; # get magnitude
1398 if ($metric) { # error checking
1399 print "Units error!" unless $x =~ /\Gkg\./g;
1402 print "Units error!" unless $x =~ /\Glbs\./g;
1404 $x =~ /\G\s+(widget|sprocket)/g; # continue processing
1406 The combination of C<//g> and C<\G> allows us to process the string a
1407 bit at a time and use arbitrary Perl logic to decide what to do next.
1408 Currently, the C<\G> anchor is only fully supported when used to anchor
1409 to the start of the pattern.
1411 C<\G> is also invaluable in processing fixed length records with
1412 regexps. Suppose we have a snippet of coding region DNA, encoded as
1413 base pair letters C<ATCGTTGAAT...> and we want to find all the stop
1414 codons C<TGA>. In a coding region, codons are 3-letter sequences, so
1415 we can think of the DNA snippet as a sequence of 3-letter records. The
1418 # expanded, this is "ATC GTT GAA TGC AAA TGA CAT GAC"
1419 $dna = "ATCGTTGAATGCAAATGACATGAC";
1422 doesn't work; it may match a C<TGA>, but there is no guarantee that
1423 the match is aligned with codon boundaries, e.g., the substring
1424 S<C<GTT GAA> > gives a match. A better solution is
1426 while ($dna =~ /(\w\w\w)*?TGA/g) { # note the minimal *?
1427 print "Got a TGA stop codon at position ", pos $dna, "\n";
1432 Got a TGA stop codon at position 18
1433 Got a TGA stop codon at position 23
1435 Position 18 is good, but position 23 is bogus. What happened?
1437 The answer is that our regexp works well until we get past the last
1438 real match. Then the regexp will fail to match a synchronized C<TGA>
1439 and start stepping ahead one character position at a time, not what we
1440 want. The solution is to use C<\G> to anchor the match to the codon
1443 while ($dna =~ /\G(\w\w\w)*?TGA/g) {
1444 print "Got a TGA stop codon at position ", pos $dna, "\n";
1449 Got a TGA stop codon at position 18
1451 which is the correct answer. This example illustrates that it is
1452 important not only to match what is desired, but to reject what is not
1455 B<search and replace>
1457 Regular expressions also play a big role in B<search and replace>
1458 operations in Perl. Search and replace is accomplished with the
1459 C<s///> operator. The general form is
1460 C<s/regexp/replacement/modifiers>, with everything we know about
1461 regexps and modifiers applying in this case as well. The
1462 C<replacement> is a Perl double quoted string that replaces in the
1463 string whatever is matched with the C<regexp>. The operator C<=~> is
1464 also used here to associate a string with C<s///>. If matching
1465 against C<$_>, the S<C<$_ =~> > can be dropped. If there is a match,
1466 C<s///> returns the number of substitutions made, otherwise it returns
1467 false. Here are a few examples:
1469 $x = "Time to feed the cat!";
1470 $x =~ s/cat/hacker/; # $x contains "Time to feed the hacker!"
1471 if ($x =~ s/^(Time.*hacker)!$/$1 now!/) {
1472 $more_insistent = 1;
1474 $y = "'quoted words'";
1475 $y =~ s/^'(.*)'$/$1/; # strip single quotes,
1476 # $y contains "quoted words"
1478 In the last example, the whole string was matched, but only the part
1479 inside the single quotes was grouped. With the C<s///> operator, the
1480 matched variables C<$1>, C<$2>, etc. are immediately available for use
1481 in the replacement expression, so we use C<$1> to replace the quoted
1482 string with just what was quoted. With the global modifier, C<s///g>
1483 will search and replace all occurrences of the regexp in the string:
1485 $x = "I batted 4 for 4";
1486 $x =~ s/4/four/; # doesn't do it all:
1487 # $x contains "I batted four for 4"
1488 $x = "I batted 4 for 4";
1489 $x =~ s/4/four/g; # does it all:
1490 # $x contains "I batted four for four"
1492 If you prefer 'regex' over 'regexp' in this tutorial, you could use
1493 the following program to replace it:
1495 % cat > simple_replace
1498 $replacement = shift;
1500 s/$regexp/$replacement/go;
1505 % simple_replace regexp regex perlretut.pod
1507 In C<simple_replace> we used the C<s///g> modifier to replace all
1508 occurrences of the regexp on each line and the C<s///o> modifier to
1509 compile the regexp only once. As with C<simple_grep>, both the
1510 C<print> and the C<s/$regexp/$replacement/go> use C<$_> implicitly.
1512 A modifier available specifically to search and replace is the
1513 C<s///e> evaluation modifier. C<s///e> wraps an C<eval{...}> around
1514 the replacement string and the evaluated result is substituted for the
1515 matched substring. C<s///e> is useful if you need to do a bit of
1516 computation in the process of replacing text. This example counts
1517 character frequencies in a line:
1519 $x = "Bill the cat";
1520 $x =~ s/(.)/$chars{$1}++;$1/eg; # final $1 replaces char with itself
1521 print "frequency of '$_' is $chars{$_}\n"
1522 foreach (sort {$chars{$b} <=> $chars{$a}} keys %chars);
1526 frequency of ' ' is 2
1527 frequency of 't' is 2
1528 frequency of 'l' is 2
1529 frequency of 'B' is 1
1530 frequency of 'c' is 1
1531 frequency of 'e' is 1
1532 frequency of 'h' is 1
1533 frequency of 'i' is 1
1534 frequency of 'a' is 1
1536 As with the match C<m//> operator, C<s///> can use other delimiters,
1537 such as C<s!!!> and C<s{}{}>, and even C<s{}//>. If single quotes are
1538 used C<s'''>, then the regexp and replacement are treated as single
1539 quoted strings and there are no substitutions. C<s///> in list context
1540 returns the same thing as in scalar context, i.e., the number of
1543 B<The split operator>
1545 The B<C<split> > function can also optionally use a matching operator
1546 C<m//> to split a string. C<split /regexp/, string, limit> splits
1547 C<string> into a list of substrings and returns that list. The regexp
1548 is used to match the character sequence that the C<string> is split
1549 with respect to. The C<limit>, if present, constrains splitting into
1550 no more than C<limit> number of strings. For example, to split a
1551 string into words, use
1553 $x = "Calvin and Hobbes";
1554 @words = split /\s+/, $x; # $word[0] = 'Calvin'
1556 # $word[2] = 'Hobbes'
1558 If the empty regexp C<//> is used, the regexp always matches and
1559 the string is split into individual characters. If the regexp has
1560 groupings, then list produced contains the matched substrings from the
1561 groupings as well. For instance,
1563 $x = "/usr/bin/perl";
1564 @dirs = split m!/!, $x; # $dirs[0] = ''
1568 @parts = split m!(/)!, $x; # $parts[0] = ''
1574 # $parts[6] = 'perl'
1576 Since the first character of $x matched the regexp, C<split> prepended
1577 an empty initial element to the list.
1579 If you have read this far, congratulations! You now have all the basic
1580 tools needed to use regular expressions to solve a wide range of text
1581 processing problems. If this is your first time through the tutorial,
1582 why not stop here and play around with regexps a while... S<Part 2>
1583 concerns the more esoteric aspects of regular expressions and those
1584 concepts certainly aren't needed right at the start.
1586 =head1 Part 2: Power tools
1588 OK, you know the basics of regexps and you want to know more. If
1589 matching regular expressions is analogous to a walk in the woods, then
1590 the tools discussed in Part 1 are analogous to topo maps and a
1591 compass, basic tools we use all the time. Most of the tools in part 2
1592 are analogous to flare guns and satellite phones. They aren't used
1593 too often on a hike, but when we are stuck, they can be invaluable.
1595 What follows are the more advanced, less used, or sometimes esoteric
1596 capabilities of perl regexps. In Part 2, we will assume you are
1597 comfortable with the basics and concentrate on the new features.
1599 =head2 More on characters, strings, and character classes
1601 There are a number of escape sequences and character classes that we
1602 haven't covered yet.
1604 There are several escape sequences that convert characters or strings
1605 between upper and lower case. C<\l> and C<\u> convert the next
1606 character to lower or upper case, respectively:
1609 $string =~ /\u$x/; # matches 'Perl' in $string
1610 $x = "M(rs?|s)\\."; # note the double backslash
1611 $string =~ /\l$x/; # matches 'mr.', 'mrs.', and 'ms.',
1613 C<\L> and C<\U> converts a whole substring, delimited by C<\L> or
1614 C<\U> and C<\E>, to lower or upper case:
1616 $x = "This word is in lower case:\L SHOUT\E";
1617 $x =~ /shout/; # matches
1618 $x = "I STILL KEYPUNCH CARDS FOR MY 360"
1619 $x =~ /\Ukeypunch/; # matches punch card string
1621 If there is no C<\E>, case is converted until the end of the
1622 string. The regexps C<\L\u$word> or C<\u\L$word> convert the first
1623 character of C<$word> to uppercase and the rest of the characters to
1626 Control characters can be escaped with C<\c>, so that a control-Z
1627 character would be matched with C<\cZ>. The escape sequence
1628 C<\Q>...C<\E> quotes, or protects most non-alphabetic characters. For
1631 $x = "\QThat !^*&%~& cat!";
1632 $x =~ /\Q!^*&%~&\E/; # check for rough language
1634 It does not protect C<$> or C<@>, so that variables can still be
1637 With the advent of 5.6.0, perl regexps can handle more than just the
1638 standard ASCII character set. Perl now supports B<Unicode>, a standard
1639 for encoding the character sets from many of the world's written
1640 languages. Unicode does this by allowing characters to be more than
1641 one byte wide. Perl uses the UTF-8 encoding, in which ASCII characters
1642 are still encoded as one byte, but characters greater than C<chr(127)>
1643 may be stored as two or more bytes.
1645 What does this mean for regexps? Well, regexp users don't need to know
1646 much about perl's internal representation of strings. But they do need
1647 to know 1) how to represent Unicode characters in a regexp and 2) when
1648 a matching operation will treat the string to be searched as a
1649 sequence of bytes (the old way) or as a sequence of Unicode characters
1650 (the new way). The answer to 1) is that Unicode characters greater
1651 than C<chr(127)> may be represented using the C<\x{hex}> notation,
1652 with C<hex> a hexadecimal integer:
1654 /\x{263a}/; # match a Unicode smiley face :)
1656 Unicode characters in the range of 128-255 use two hexadecimal digits
1657 with braces: C<\x{ab}>. Note that this is different than C<\xab>,
1658 which is just a hexadecimal byte with no Unicode significance.
1660 B<NOTE>: in Perl 5.6.0 it used to be that one needed to say C<use
1661 utf8> to use any Unicode features. This is no more the case: for
1662 almost all Unicode processing, the explicit C<utf8> pragma is not
1663 needed. (The only case where it matters is if your Perl script is in
1664 Unicode and encoded in UTF-8, then an explicit C<use utf8> is needed.)
1666 Figuring out the hexadecimal sequence of a Unicode character you want
1667 or deciphering someone else's hexadecimal Unicode regexp is about as
1668 much fun as programming in machine code. So another way to specify
1669 Unicode characters is to use the S<B<named character> > escape
1670 sequence C<\N{name}>. C<name> is a name for the Unicode character, as
1671 specified in the Unicode standard. For instance, if we wanted to
1672 represent or match the astrological sign for the planet Mercury, we
1675 use charnames ":full"; # use named chars with Unicode full names
1676 $x = "abc\N{MERCURY}def";
1677 $x =~ /\N{MERCURY}/; # matches
1679 One can also use short names or restrict names to a certain alphabet:
1681 use charnames ':full';
1682 print "\N{GREEK SMALL LETTER SIGMA} is called sigma.\n";
1684 use charnames ":short";
1685 print "\N{greek:Sigma} is an upper-case sigma.\n";
1687 use charnames qw(greek);
1688 print "\N{sigma} is Greek sigma\n";
1690 A list of full names is found in the file Names.txt in the
1691 lib/perl5/5.X.X/unicore directory.
1693 The answer to requirement 2), as of 5.6.0, is that if a regexp
1694 contains Unicode characters, the string is searched as a sequence of
1695 Unicode characters. Otherwise, the string is searched as a sequence of
1696 bytes. If the string is being searched as a sequence of Unicode
1697 characters, but matching a single byte is required, we can use the C<\C>
1698 escape sequence. C<\C> is a character class akin to C<.> except that
1699 it matches I<any> byte 0-255. So
1701 use charnames ":full"; # use named chars with Unicode full names
1703 $x =~ /\C/; # matches 'a', eats one byte
1705 $x =~ /\C/; # doesn't match, no bytes to match
1706 $x = "\N{MERCURY}"; # two-byte Unicode character
1707 $x =~ /\C/; # matches, but dangerous!
1709 The last regexp matches, but is dangerous because the string
1710 I<character> position is no longer synchronized to the string I<byte>
1711 position. This generates the warning 'Malformed UTF-8
1712 character'. The C<\C> is best used for matching the binary data in strings
1713 with binary data intermixed with Unicode characters.
1715 Let us now discuss the rest of the character classes. Just as with
1716 Unicode characters, there are named Unicode character classes
1717 represented by the C<\p{name}> escape sequence. Closely associated is
1718 the C<\P{name}> character class, which is the negation of the
1719 C<\p{name}> class. For example, to match lower and uppercase
1722 use charnames ":full"; # use named chars with Unicode full names
1724 $x =~ /^\p{IsUpper}/; # matches, uppercase char class
1725 $x =~ /^\P{IsUpper}/; # doesn't match, char class sans uppercase
1726 $x =~ /^\p{IsLower}/; # doesn't match, lowercase char class
1727 $x =~ /^\P{IsLower}/; # matches, char class sans lowercase
1729 Here is the association between some Perl named classes and the
1730 traditional Unicode classes:
1732 Perl class name Unicode class name or regular expression
1736 IsASCII $code <= 127
1738 IsBlank $code =~ /^(0020|0009)$/ || /^Z[^lp]/
1740 IsGraph /^([LMNPS]|Co)/
1742 IsPrint /^([LMNPS]|Co|Zs)/
1744 IsSpace /^Z/ || ($code =~ /^(0009|000A|000B|000C|000D)$/
1745 IsSpacePerl /^Z/ || ($code =~ /^(0009|000A|000C|000D|0085|2028|2029)$/
1747 IsWord /^[LMN]/ || $code eq "005F"
1748 IsXDigit $code =~ /^00(3[0-9]|[46][1-6])$/
1750 You can also use the official Unicode class names with the C<\p> and
1751 C<\P>, like C<\p{L}> for Unicode 'letters', or C<\p{Lu}> for uppercase
1752 letters, or C<\P{Nd}> for non-digits. If a C<name> is just one
1753 letter, the braces can be dropped. For instance, C<\pM> is the
1754 character class of Unicode 'marks', for example accent marks.
1755 For the full list see L<perlunicode>.
1757 The Unicode has also been separated into various sets of characters
1758 which you can test with C<\p{In...}> (in) and C<\P{In...}> (not in),
1759 for example C<\p{Latin}>, C<\p{Greek}>, or C<\P{Katakana}>.
1760 For the full list see L<perlunicode>.
1762 C<\X> is an abbreviation for a character class sequence that includes
1763 the Unicode 'combining character sequences'. A 'combining character
1764 sequence' is a base character followed by any number of combining
1765 characters. An example of a combining character is an accent. Using
1766 the Unicode full names, e.g., S<C<A + COMBINING RING> > is a combining
1767 character sequence with base character C<A> and combining character
1768 S<C<COMBINING RING> >, which translates in Danish to A with the circle
1769 atop it, as in the word Angstrom. C<\X> is equivalent to C<\PM\pM*}>,
1770 i.e., a non-mark followed by one or more marks.
1772 For the full and latest information about Unicode see the latest
1773 Unicode standard, or the Unicode Consortium's website http://www.unicode.org/
1775 As if all those classes weren't enough, Perl also defines POSIX style
1776 character classes. These have the form C<[:name:]>, with C<name> the
1777 name of the POSIX class. The POSIX classes are C<alpha>, C<alnum>,
1778 C<ascii>, C<cntrl>, C<digit>, C<graph>, C<lower>, C<print>, C<punct>,
1779 C<space>, C<upper>, and C<xdigit>, and two extensions, C<word> (a Perl
1780 extension to match C<\w>), and C<blank> (a GNU extension). If C<utf8>
1781 is being used, then these classes are defined the same as their
1782 corresponding perl Unicode classes: C<[:upper:]> is the same as
1783 C<\p{IsUpper}>, etc. The POSIX character classes, however, don't
1784 require using C<utf8>. The C<[:digit:]>, C<[:word:]>, and
1785 C<[:space:]> correspond to the familiar C<\d>, C<\w>, and C<\s>
1786 character classes. To negate a POSIX class, put a C<^> in front of
1787 the name, so that, e.g., C<[:^digit:]> corresponds to C<\D> and under
1788 C<utf8>, C<\P{IsDigit}>. The Unicode and POSIX character classes can
1789 be used just like C<\d>, with the exception that POSIX character
1790 classes can only be used inside of a character class:
1792 /\s+[abc[:digit:]xyz]\s*/; # match a,b,c,x,y,z, or a digit
1793 /^=item\s[[:digit:]]/; # match '=item',
1794 # followed by a space and a digit
1795 use charnames ":full";
1796 /\s+[abc\p{IsDigit}xyz]\s+/; # match a,b,c,x,y,z, or a digit
1797 /^=item\s\p{IsDigit}/; # match '=item',
1798 # followed by a space and a digit
1800 Whew! That is all the rest of the characters and character classes.
1802 =head2 Compiling and saving regular expressions
1804 In Part 1 we discussed the C<//o> modifier, which compiles a regexp
1805 just once. This suggests that a compiled regexp is some data structure
1806 that can be stored once and used again and again. The regexp quote
1807 C<qr//> does exactly that: C<qr/string/> compiles the C<string> as a
1808 regexp and transforms the result into a form that can be assigned to a
1811 $reg = qr/foo+bar?/; # reg contains a compiled regexp
1813 Then C<$reg> can be used as a regexp:
1816 $x =~ $reg; # matches, just like /foo+bar?/
1817 $x =~ /$reg/; # same thing, alternate form
1819 C<$reg> can also be interpolated into a larger regexp:
1821 $x =~ /(abc)?$reg/; # still matches
1823 As with the matching operator, the regexp quote can use different
1824 delimiters, e.g., C<qr!!>, C<qr{}> and C<qr~~>. The single quote
1825 delimiters C<qr''> prevent any interpolation from taking place.
1827 Pre-compiled regexps are useful for creating dynamic matches that
1828 don't need to be recompiled each time they are encountered. Using
1829 pre-compiled regexps, C<simple_grep> program can be expanded into a
1830 program that matches multiple patterns:
1834 # multi_grep - match any of <number> regexps
1835 # usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ...
1838 $regexp[$_] = shift foreach (0..$number-1);
1839 @compiled = map qr/$_/, @regexp;
1840 while ($line = <>) {
1841 foreach $pattern (@compiled) {
1842 if ($line =~ /$pattern/) {
1844 last; # we matched, so move onto the next line
1850 % multi_grep 2 last for multi_grep
1851 $regexp[$_] = shift foreach (0..$number-1);
1852 foreach $pattern (@compiled) {
1855 Storing pre-compiled regexps in an array C<@compiled> allows us to
1856 simply loop through the regexps without any recompilation, thus gaining
1857 flexibility without sacrificing speed.
1859 =head2 Embedding comments and modifiers in a regular expression
1861 Starting with this section, we will be discussing Perl's set of
1862 B<extended patterns>. These are extensions to the traditional regular
1863 expression syntax that provide powerful new tools for pattern
1864 matching. We have already seen extensions in the form of the minimal
1865 matching constructs C<??>, C<*?>, C<+?>, C<{n,m}?>, and C<{n,}?>. The
1866 rest of the extensions below have the form C<(?char...)>, where the
1867 C<char> is a character that determines the type of extension.
1869 The first extension is an embedded comment C<(?#text)>. This embeds a
1870 comment into the regular expression without affecting its meaning. The
1871 comment should not have any closing parentheses in the text. An
1874 /(?# Match an integer:)[+-]?\d+/;
1876 This style of commenting has been largely superseded by the raw,
1877 freeform commenting that is allowed with the C<//x> modifier.
1879 The modifiers C<//i>, C<//m>, C<//s>, and C<//x> can also embedded in
1880 a regexp using C<(?i)>, C<(?m)>, C<(?s)>, and C<(?x)>. For instance,
1882 /(?i)yes/; # match 'yes' case insensitively
1883 /yes/i; # same thing
1884 /(?x)( # freeform version of an integer regexp
1885 [+-]? # match an optional sign
1886 \d+ # match a sequence of digits
1890 Embedded modifiers can have two important advantages over the usual
1891 modifiers. Embedded modifiers allow a custom set of modifiers to
1892 I<each> regexp pattern. This is great for matching an array of regexps
1893 that must have different modifiers:
1895 $pattern[0] = '(?i)doctor';
1896 $pattern[1] = 'Johnson';
1899 foreach $patt (@pattern) {
1904 The second advantage is that embedded modifiers only affect the regexp
1905 inside the group the embedded modifier is contained in. So grouping
1906 can be used to localize the modifier's effects:
1908 /Answer: ((?i)yes)/; # matches 'Answer: yes', 'Answer: YES', etc.
1910 Embedded modifiers can also turn off any modifiers already present
1911 by using, e.g., C<(?-i)>. Modifiers can also be combined into
1912 a single expression, e.g., C<(?s-i)> turns on single line mode and
1913 turns off case insensitivity.
1915 =head2 Non-capturing groupings
1917 We noted in Part 1 that groupings C<()> had two distinct functions: 1)
1918 group regexp elements together as a single unit, and 2) extract, or
1919 capture, substrings that matched the regexp in the
1920 grouping. Non-capturing groupings, denoted by C<(?:regexp)>, allow the
1921 regexp to be treated as a single unit, but don't extract substrings or
1922 set matching variables C<$1>, etc. Both capturing and non-capturing
1923 groupings are allowed to co-exist in the same regexp. Because there is
1924 no extraction, non-capturing groupings are faster than capturing
1925 groupings. Non-capturing groupings are also handy for choosing exactly
1926 which parts of a regexp are to be extracted to matching variables:
1928 # match a number, $1-$4 are set, but we only want $1
1929 /([+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?)/;
1931 # match a number faster , only $1 is set
1932 /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE][+-]?\d+)?)/;
1934 # match a number, get $1 = whole number, $2 = exponent
1935 /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE]([+-]?\d+))?)/;
1937 Non-capturing groupings are also useful for removing nuisance
1938 elements gathered from a split operation:
1941 @num = split /(a|b)/, $x; # @num = ('12','a','34','b','5')
1942 @num = split /(?:a|b)/, $x; # @num = ('12','34','5')
1944 Non-capturing groupings may also have embedded modifiers:
1945 C<(?i-m:regexp)> is a non-capturing grouping that matches C<regexp>
1946 case insensitively and turns off multi-line mode.
1948 =head2 Looking ahead and looking behind
1950 This section concerns the lookahead and lookbehind assertions. First,
1951 a little background.
1953 In Perl regular expressions, most regexp elements 'eat up' a certain
1954 amount of string when they match. For instance, the regexp element
1955 C<[abc}]> eats up one character of the string when it matches, in the
1956 sense that perl moves to the next character position in the string
1957 after the match. There are some elements, however, that don't eat up
1958 characters (advance the character position) if they match. The examples
1959 we have seen so far are the anchors. The anchor C<^> matches the
1960 beginning of the line, but doesn't eat any characters. Similarly, the
1961 word boundary anchor C<\b> matches, e.g., if the character to the left
1962 is a word character and the character to the right is a non-word
1963 character, but it doesn't eat up any characters itself. Anchors are
1964 examples of 'zero-width assertions'. Zero-width, because they consume
1965 no characters, and assertions, because they test some property of the
1966 string. In the context of our walk in the woods analogy to regexp
1967 matching, most regexp elements move us along a trail, but anchors have
1968 us stop a moment and check our surroundings. If the local environment
1969 checks out, we can proceed forward. But if the local environment
1970 doesn't satisfy us, we must backtrack.
1972 Checking the environment entails either looking ahead on the trail,
1973 looking behind, or both. C<^> looks behind, to see that there are no
1974 characters before. C<$> looks ahead, to see that there are no
1975 characters after. C<\b> looks both ahead and behind, to see if the
1976 characters on either side differ in their 'word'-ness.
1978 The lookahead and lookbehind assertions are generalizations of the
1979 anchor concept. Lookahead and lookbehind are zero-width assertions
1980 that let us specify which characters we want to test for. The
1981 lookahead assertion is denoted by C<(?=regexp)> and the lookbehind
1982 assertion is denoted by C<< (?<=fixed-regexp) >>. Some examples are
1984 $x = "I catch the housecat 'Tom-cat' with catnip";
1985 $x =~ /cat(?=\s+)/; # matches 'cat' in 'housecat'
1986 @catwords = ($x =~ /(?<=\s)cat\w+/g); # matches,
1987 # $catwords[0] = 'catch'
1988 # $catwords[1] = 'catnip'
1989 $x =~ /\bcat\b/; # matches 'cat' in 'Tom-cat'
1990 $x =~ /(?<=\s)cat(?=\s)/; # doesn't match; no isolated 'cat' in
1993 Note that the parentheses in C<(?=regexp)> and C<< (?<=regexp) >> are
1994 non-capturing, since these are zero-width assertions. Thus in the
1995 second regexp, the substrings captured are those of the whole regexp
1996 itself. Lookahead C<(?=regexp)> can match arbitrary regexps, but
1997 lookbehind C<< (?<=fixed-regexp) >> only works for regexps of fixed
1998 width, i.e., a fixed number of characters long. Thus
1999 C<< (?<=(ab|bc)) >> is fine, but C<< (?<=(ab)*) >> is not. The
2000 negated versions of the lookahead and lookbehind assertions are
2001 denoted by C<(?!regexp)> and C<< (?<!fixed-regexp) >> respectively.
2002 They evaluate true if the regexps do I<not> match:
2005 $x =~ /foo(?!bar)/; # doesn't match, 'bar' follows 'foo'
2006 $x =~ /foo(?!baz)/; # matches, 'baz' doesn't follow 'foo'
2007 $x =~ /(?<!\s)foo/; # matches, there is no \s before 'foo'
2009 The C<\C> is unsupported in lookbehind, because the already
2010 treacherous definition of C<\C> would become even more so
2011 when going backwards.
2013 =head2 Using independent subexpressions to prevent backtracking
2015 The last few extended patterns in this tutorial are experimental as of
2016 5.6.0. Play with them, use them in some code, but don't rely on them
2017 just yet for production code.
2019 S<B<Independent subexpressions> > are regular expressions, in the
2020 context of a larger regular expression, that function independently of
2021 the larger regular expression. That is, they consume as much or as
2022 little of the string as they wish without regard for the ability of
2023 the larger regexp to match. Independent subexpressions are represented
2024 by C<< (?>regexp) >>. We can illustrate their behavior by first
2025 considering an ordinary regexp:
2028 $x =~ /a*ab/; # matches
2030 This obviously matches, but in the process of matching, the
2031 subexpression C<a*> first grabbed the C<a>. Doing so, however,
2032 wouldn't allow the whole regexp to match, so after backtracking, C<a*>
2033 eventually gave back the C<a> and matched the empty string. Here, what
2034 C<a*> matched was I<dependent> on what the rest of the regexp matched.
2036 Contrast that with an independent subexpression:
2038 $x =~ /(?>a*)ab/; # doesn't match!
2040 The independent subexpression C<< (?>a*) >> doesn't care about the rest
2041 of the regexp, so it sees an C<a> and grabs it. Then the rest of the
2042 regexp C<ab> cannot match. Because C<< (?>a*) >> is independent, there
2043 is no backtracking and the independent subexpression does not give
2044 up its C<a>. Thus the match of the regexp as a whole fails. A similar
2045 behavior occurs with completely independent regexps:
2048 $x =~ /a*/g; # matches, eats an 'a'
2049 $x =~ /\Gab/g; # doesn't match, no 'a' available
2051 Here C<//g> and C<\G> create a 'tag team' handoff of the string from
2052 one regexp to the other. Regexps with an independent subexpression are
2053 much like this, with a handoff of the string to the independent
2054 subexpression, and a handoff of the string back to the enclosing
2057 The ability of an independent subexpression to prevent backtracking
2058 can be quite useful. Suppose we want to match a non-empty string
2059 enclosed in parentheses up to two levels deep. Then the following
2062 $x = "abc(de(fg)h"; # unbalanced parentheses
2063 $x =~ /\( ( [^()]+ | \([^()]*\) )+ \)/x;
2065 The regexp matches an open parenthesis, one or more copies of an
2066 alternation, and a close parenthesis. The alternation is two-way, with
2067 the first alternative C<[^()]+> matching a substring with no
2068 parentheses and the second alternative C<\([^()]*\)> matching a
2069 substring delimited by parentheses. The problem with this regexp is
2070 that it is pathological: it has nested indeterminate quantifiers
2071 of the form C<(a+|b)+>. We discussed in Part 1 how nested quantifiers
2072 like this could take an exponentially long time to execute if there
2073 was no match possible. To prevent the exponential blowup, we need to
2074 prevent useless backtracking at some point. This can be done by
2075 enclosing the inner quantifier as an independent subexpression:
2077 $x =~ /\( ( (?>[^()]+) | \([^()]*\) )+ \)/x;
2079 Here, C<< (?>[^()]+) >> breaks the degeneracy of string partitioning
2080 by gobbling up as much of the string as possible and keeping it. Then
2081 match failures fail much more quickly.
2083 =head2 Conditional expressions
2085 A S<B<conditional expression> > is a form of if-then-else statement
2086 that allows one to choose which patterns are to be matched, based on
2087 some condition. There are two types of conditional expression:
2088 C<(?(condition)yes-regexp)> and
2089 C<(?(condition)yes-regexp|no-regexp)>. C<(?(condition)yes-regexp)> is
2090 like an S<C<'if () {}'> > statement in Perl. If the C<condition> is true,
2091 the C<yes-regexp> will be matched. If the C<condition> is false, the
2092 C<yes-regexp> will be skipped and perl will move onto the next regexp
2093 element. The second form is like an S<C<'if () {} else {}'> > statement
2094 in Perl. If the C<condition> is true, the C<yes-regexp> will be
2095 matched, otherwise the C<no-regexp> will be matched.
2097 The C<condition> can have two forms. The first form is simply an
2098 integer in parentheses C<(integer)>. It is true if the corresponding
2099 backreference C<\integer> matched earlier in the regexp. The second
2100 form is a bare zero width assertion C<(?...)>, either a
2101 lookahead, a lookbehind, or a code assertion (discussed in the next
2104 The integer form of the C<condition> allows us to choose, with more
2105 flexibility, what to match based on what matched earlier in the
2106 regexp. This searches for words of the form C<"$x$x"> or
2109 % simple_grep '^(\w+)(\w+)?(?(2)\2\1|\1)$' /usr/dict/words
2119 The lookbehind C<condition> allows, along with backreferences,
2120 an earlier part of the match to influence a later part of the
2121 match. For instance,
2123 /[ATGC]+(?(?<=AA)G|C)$/;
2125 matches a DNA sequence such that it either ends in C<AAG>, or some
2126 other base pair combination and C<C>. Note that the form is
2127 C<< (?(?<=AA)G|C) >> and not C<< (?((?<=AA))G|C) >>; for the
2128 lookahead, lookbehind or code assertions, the parentheses around the
2129 conditional are not needed.
2131 =head2 A bit of magic: executing Perl code in a regular expression
2133 Normally, regexps are a part of Perl expressions.
2134 S<B<Code evaluation> > expressions turn that around by allowing
2135 arbitrary Perl code to be a part of a regexp. A code evaluation
2136 expression is denoted C<(?{code})>, with C<code> a string of Perl
2139 Code expressions are zero-width assertions, and the value they return
2140 depends on their environment. There are two possibilities: either the
2141 code expression is used as a conditional in a conditional expression
2142 C<(?(condition)...)>, or it is not. If the code expression is a
2143 conditional, the code is evaluated and the result (i.e., the result of
2144 the last statement) is used to determine truth or falsehood. If the
2145 code expression is not used as a conditional, the assertion always
2146 evaluates true and the result is put into the special variable
2147 C<$^R>. The variable C<$^R> can then be used in code expressions later
2148 in the regexp. Here are some silly examples:
2151 $x =~ /abc(?{print "Hi Mom!";})def/; # matches,
2153 $x =~ /aaa(?{print "Hi Mom!";})def/; # doesn't match,
2156 Pay careful attention to the next example:
2158 $x =~ /abc(?{print "Hi Mom!";})ddd/; # doesn't match,
2162 At first glance, you'd think that it shouldn't print, because obviously
2163 the C<ddd> isn't going to match the target string. But look at this
2166 $x =~ /abc(?{print "Hi Mom!";})[d]dd/; # doesn't match,
2169 Hmm. What happened here? If you've been following along, you know that
2170 the above pattern should be effectively the same as the last one --
2171 enclosing the d in a character class isn't going to change what it
2172 matches. So why does the first not print while the second one does?
2174 The answer lies in the optimizations the REx engine makes. In the first
2175 case, all the engine sees are plain old characters (aside from the
2176 C<?{}> construct). It's smart enough to realize that the string 'ddd'
2177 doesn't occur in our target string before actually running the pattern
2178 through. But in the second case, we've tricked it into thinking that our
2179 pattern is more complicated than it is. It takes a look, sees our
2180 character class, and decides that it will have to actually run the
2181 pattern to determine whether or not it matches, and in the process of
2182 running it hits the print statement before it discovers that we don't
2185 To take a closer look at how the engine does optimizations, see the
2186 section L<"Pragmas and debugging"> below.
2188 More fun with C<?{}>:
2190 $x =~ /(?{print "Hi Mom!";})/; # matches,
2192 $x =~ /(?{$c = 1;})(?{print "$c";})/; # matches,
2194 $x =~ /(?{$c = 1;})(?{print "$^R";})/; # matches,
2197 The bit of magic mentioned in the section title occurs when the regexp
2198 backtracks in the process of searching for a match. If the regexp
2199 backtracks over a code expression and if the variables used within are
2200 localized using C<local>, the changes in the variables produced by the
2201 code expression are undone! Thus, if we wanted to count how many times
2202 a character got matched inside a group, we could use, e.g.,
2205 $count = 0; # initialize 'a' count
2206 $c = "bob"; # test if $c gets clobbered
2207 $x =~ /(?{local $c = 0;}) # initialize count
2209 (?{local $c = $c + 1;}) # increment count
2210 )* # do this any number of times,
2211 aa # but match 'aa' at the end
2212 (?{$count = $c;}) # copy local $c var into $count
2214 print "'a' count is $count, \$c variable is '$c'\n";
2218 'a' count is 2, $c variable is 'bob'
2220 If we replace the S<C< (?{local $c = $c + 1;})> > with
2221 S<C< (?{$c = $c + 1;})> >, the variable changes are I<not> undone
2222 during backtracking, and we get
2224 'a' count is 4, $c variable is 'bob'
2226 Note that only localized variable changes are undone. Other side
2227 effects of code expression execution are permanent. Thus
2230 $x =~ /(a(?{print "Yow\n";}))*aa/;
2239 The result C<$^R> is automatically localized, so that it will behave
2240 properly in the presence of backtracking.
2242 This example uses a code expression in a conditional to match the
2243 article 'the' in either English or German:
2245 $lang = 'DE'; # use German
2250 $lang eq 'EN'; # is the language English?
2252 the | # if so, then match 'the'
2253 (die|das|der) # else, match 'die|das|der'
2257 Note that the syntax here is C<(?(?{...})yes-regexp|no-regexp)>, not
2258 C<(?((?{...}))yes-regexp|no-regexp)>. In other words, in the case of a
2259 code expression, we don't need the extra parentheses around the
2262 If you try to use code expressions with interpolating variables, perl
2267 /foo(?{ $bar })bar/; # compiles ok, $bar not interpolated
2268 /foo(?{ 1 })$bar/; # compile error!
2269 /foo${pat}bar/; # compile error!
2271 $pat = qr/(?{ $foo = 1 })/; # precompile code regexp
2272 /foo${pat}bar/; # compiles ok
2274 If a regexp has (1) code expressions and interpolating variables, or
2275 (2) a variable that interpolates a code expression, perl treats the
2276 regexp as an error. If the code expression is precompiled into a
2277 variable, however, interpolating is ok. The question is, why is this
2280 The reason is that variable interpolation and code expressions
2281 together pose a security risk. The combination is dangerous because
2282 many programmers who write search engines often take user input and
2283 plug it directly into a regexp:
2285 $regexp = <>; # read user-supplied regexp
2286 $chomp $regexp; # get rid of possible newline
2287 $text =~ /$regexp/; # search $text for the $regexp
2289 If the C<$regexp> variable contains a code expression, the user could
2290 then execute arbitrary Perl code. For instance, some joker could
2291 search for S<C<system('rm -rf *');> > to erase your files. In this
2292 sense, the combination of interpolation and code expressions B<taints>
2293 your regexp. So by default, using both interpolation and code
2294 expressions in the same regexp is not allowed. If you're not
2295 concerned about malicious users, it is possible to bypass this
2296 security check by invoking S<C<use re 'eval'> >:
2298 use re 'eval'; # throw caution out the door
2301 /foo(?{ 1 })$bar/; # compiles ok
2302 /foo${pat}bar/; # compiles ok
2304 Another form of code expression is the S<B<pattern code expression> >.
2305 The pattern code expression is like a regular code expression, except
2306 that the result of the code evaluation is treated as a regular
2307 expression and matched immediately. A simple example is
2312 $x =~ /(??{$char x $length})/x; # matches, there are 5 of 'a'
2315 This final example contains both ordinary and pattern code
2316 expressions. It detects if a binary string C<1101010010001...> has a
2317 Fibonacci spacing 0,1,1,2,3,5,... of the C<1>'s:
2319 $s0 = 0; $s1 = 1; # initial conditions
2320 $x = "1101010010001000001";
2321 print "It is a Fibonacci sequence\n"
2322 if $x =~ /^1 # match an initial '1'
2324 (??{'0' x $s0}) # match $s0 of '0'
2327 $largest = $s0; # largest seq so far
2328 $s2 = $s1 + $s0; # compute next term
2329 $s0 = $s1; # in Fibonacci sequence
2332 )+ # repeat as needed
2333 $ # that is all there is
2335 print "Largest sequence matched was $largest\n";
2339 It is a Fibonacci sequence
2340 Largest sequence matched was 5
2342 Ha! Try that with your garden variety regexp package...
2344 Note that the variables C<$s0> and C<$s1> are not substituted when the
2345 regexp is compiled, as happens for ordinary variables outside a code
2346 expression. Rather, the code expressions are evaluated when perl
2347 encounters them during the search for a match.
2349 The regexp without the C<//x> modifier is
2351 /^1((??{'0'x$s0})1(?{$largest=$s0;$s2=$s1+$s0$s0=$s1;$s1=$s2;}))+$/;
2353 and is a great start on an Obfuscated Perl entry :-) When working with
2354 code and conditional expressions, the extended form of regexps is
2355 almost necessary in creating and debugging regexps.
2357 =head2 Pragmas and debugging
2359 Speaking of debugging, there are several pragmas available to control
2360 and debug regexps in Perl. We have already encountered one pragma in
2361 the previous section, S<C<use re 'eval';> >, that allows variable
2362 interpolation and code expressions to coexist in a regexp. The other
2367 @parts = ($tainted =~ /(\w+)\s+(\w+)/; # @parts is now tainted
2369 The C<taint> pragma causes any substrings from a match with a tainted
2370 variable to be tainted as well. This is not normally the case, as
2371 regexps are often used to extract the safe bits from a tainted
2372 variable. Use C<taint> when you are not extracting safe bits, but are
2373 performing some other processing. Both C<taint> and C<eval> pragmas
2374 are lexically scoped, which means they are in effect only until
2375 the end of the block enclosing the pragmas.
2378 /^(.*)$/s; # output debugging info
2380 use re 'debugcolor';
2381 /^(.*)$/s; # output debugging info in living color
2383 The global C<debug> and C<debugcolor> pragmas allow one to get
2384 detailed debugging info about regexp compilation and
2385 execution. C<debugcolor> is the same as debug, except the debugging
2386 information is displayed in color on terminals that can display
2387 termcap color sequences. Here is example output:
2389 % perl -e 'use re "debug"; "abc" =~ /a*b+c/;'
2390 Compiling REx `a*b+c'
2398 floating `bc' at 0..2147483647 (checking floating) minlen 2
2399 Guessing start of match, REx `a*b+c' against `abc'...
2400 Found floating substr `bc' at offset 1...
2401 Guessed: match at offset 0
2402 Matching REx `a*b+c' against `abc'
2403 Setting an EVAL scope, savestack=3
2404 0 <> <abc> | 1: STAR
2405 EXACT <a> can match 1 times out of 32767...
2406 Setting an EVAL scope, savestack=3
2407 1 <a> <bc> | 4: PLUS
2408 EXACT <b> can match 1 times out of 32767...
2409 Setting an EVAL scope, savestack=3
2410 2 <ab> <c> | 7: EXACT <c>
2413 Freeing REx: `a*b+c'
2415 If you have gotten this far into the tutorial, you can probably guess
2416 what the different parts of the debugging output tell you. The first
2419 Compiling REx `a*b+c'
2428 describes the compilation stage. C<STAR(4)> means that there is a
2429 starred object, in this case C<'a'>, and if it matches, goto line 4,
2430 i.e., C<PLUS(7)>. The middle lines describe some heuristics and
2431 optimizations performed before a match:
2433 floating `bc' at 0..2147483647 (checking floating) minlen 2
2434 Guessing start of match, REx `a*b+c' against `abc'...
2435 Found floating substr `bc' at offset 1...
2436 Guessed: match at offset 0
2438 Then the match is executed and the remaining lines describe the
2441 Matching REx `a*b+c' against `abc'
2442 Setting an EVAL scope, savestack=3
2443 0 <> <abc> | 1: STAR
2444 EXACT <a> can match 1 times out of 32767...
2445 Setting an EVAL scope, savestack=3
2446 1 <a> <bc> | 4: PLUS
2447 EXACT <b> can match 1 times out of 32767...
2448 Setting an EVAL scope, savestack=3
2449 2 <ab> <c> | 7: EXACT <c>
2452 Freeing REx: `a*b+c'
2454 Each step is of the form S<C<< n <x> <y> >> >, with C<< <x> >> the
2455 part of the string matched and C<< <y> >> the part not yet
2456 matched. The S<C<< | 1: STAR >> > says that perl is at line number 1
2457 n the compilation list above. See
2458 L<perldebguts/"Debugging regular expressions"> for much more detail.
2460 An alternative method of debugging regexps is to embed C<print>
2461 statements within the regexp. This provides a blow-by-blow account of
2462 the backtracking in an alternation:
2464 "that this" =~ m@(?{print "Start at position ", pos, "\n";})
2474 (?{print "Done at position ", pos, "\n";})
2490 Code expressions, conditional expressions, and independent expressions
2491 are B<experimental>. Don't use them in production code. Yet.
2495 This is just a tutorial. For the full story on perl regular
2496 expressions, see the L<perlre> regular expressions reference page.
2498 For more information on the matching C<m//> and substitution C<s///>
2499 operators, see L<perlop/"Regexp Quote-Like Operators">. For
2500 information on the C<split> operation, see L<perlfunc/split>.
2502 For an excellent all-around resource on the care and feeding of
2503 regular expressions, see the book I<Mastering Regular Expressions> by
2504 Jeffrey Friedl (published by O'Reilly, ISBN 1556592-257-3).
2506 =head1 AUTHOR AND COPYRIGHT
2508 Copyright (c) 2000 Mark Kvale
2509 All rights reserved.
2511 This document may be distributed under the same terms as Perl itself.
2513 =head2 Acknowledgments
2515 The inspiration for the stop codon DNA example came from the ZIP
2516 code example in chapter 7 of I<Mastering Regular Expressions>.
2518 The author would like to thank Jeff Pinyan, Andrew Johnson, Peter
2519 Haworth, Ronald J Kimball, and Joe Smith for all their helpful