3 perlretut - Perl regular expressions tutorial
7 This page provides a basic tutorial on understanding, creating and
8 using regular expressions in Perl. It serves as a complement to the
9 reference page on regular expressions L<perlre>. Regular expressions
10 are an integral part of the C<m//>, C<s///>, C<qr//> and C<split>
11 operators and so this tutorial also overlaps with
12 L<perlop/"Regexp Quote-Like Operators"> and L<perlfunc/split>.
14 Perl is widely renowned for excellence in text processing, and regular
15 expressions are one of the big factors behind this fame. Perl regular
16 expressions display an efficiency and flexibility unknown in most
17 other computer languages. Mastering even the basics of regular
18 expressions will allow you to manipulate text with surprising ease.
20 What is a regular expression? A regular expression is simply a string
21 that describes a pattern. Patterns are in common use these days;
22 examples are the patterns typed into a search engine to find web pages
23 and the patterns used to list files in a directory, e.g., C<ls *.txt>
24 or C<dir *.*>. In Perl, the patterns described by regular expressions
25 are used to search strings, extract desired parts of strings, and to
26 do search and replace operations.
28 Regular expressions have the undeserved reputation of being abstract
29 and difficult to understand. Regular expressions are constructed using
30 simple concepts like conditionals and loops and are no more difficult
31 to understand than the corresponding C<if> conditionals and C<while>
32 loops in the Perl language itself. In fact, the main challenge in
33 learning regular expressions is just getting used to the terse
34 notation used to express these concepts.
36 This tutorial flattens the learning curve by discussing regular
37 expression concepts, along with their notation, one at a time and with
38 many examples. The first part of the tutorial will progress from the
39 simplest word searches to the basic regular expression concepts. If
40 you master the first part, you will have all the tools needed to solve
41 about 98% of your needs. The second part of the tutorial is for those
42 comfortable with the basics and hungry for more power tools. It
43 discusses the more advanced regular expression operators and
44 introduces the latest cutting edge innovations in 5.6.0.
46 A note: to save time, 'regular expression' is often abbreviated as
47 regexp or regex. Regexp is a more natural abbreviation than regex, but
48 is harder to pronounce. The Perl pod documentation is evenly split on
49 regexp vs regex; in Perl, there is more than one way to abbreviate it.
50 We'll use regexp in this tutorial.
52 =head1 Part 1: The basics
54 =head2 Simple word matching
56 The simplest regexp is simply a word, or more generally, a string of
57 characters. A regexp consisting of a word matches any string that
60 "Hello World" =~ /World/; # matches
62 What is this perl statement all about? C<"Hello World"> is a simple
63 double quoted string. C<World> is the regular expression and the
64 C<//> enclosing C</World/> tells perl to search a string for a match.
65 The operator C<=~> associates the string with the regexp match and
66 produces a true value if the regexp matched, or false if the regexp
67 did not match. In our case, C<World> matches the second word in
68 C<"Hello World">, so the expression is true. Expressions like this
69 are useful in conditionals:
71 if ("Hello World" =~ /World/) {
75 print "It doesn't match\n";
78 There are useful variations on this theme. The sense of the match can
79 be reversed by using C<!~> operator:
81 if ("Hello World" !~ /World/) {
82 print "It doesn't match\n";
88 The literal string in the regexp can be replaced by a variable:
91 if ("Hello World" =~ /$greeting/) {
95 print "It doesn't match\n";
98 If you're matching against the special default variable C<$_>, the
99 C<$_ =~> part can be omitted:
103 print "It matches\n";
106 print "It doesn't match\n";
109 And finally, the C<//> default delimiters for a match can be changed
110 to arbitrary delimiters by putting an C<'m'> out front:
112 "Hello World" =~ m!World!; # matches, delimited by '!'
113 "Hello World" =~ m{World}; # matches, note the matching '{}'
114 "/usr/bin/perl" =~ m"/perl"; # matches after '/usr/bin',
115 # '/' becomes an ordinary char
117 C</World/>, C<m!World!>, and C<m{World}> all represent the
118 same thing. When, e.g., C<""> is used as a delimiter, the forward
119 slash C<'/'> becomes an ordinary character and can be used in a regexp
122 Let's consider how different regexps would match C<"Hello World">:
124 "Hello World" =~ /world/; # doesn't match
125 "Hello World" =~ /o W/; # matches
126 "Hello World" =~ /oW/; # doesn't match
127 "Hello World" =~ /World /; # doesn't match
129 The first regexp C<world> doesn't match because regexps are
130 case-sensitive. The second regexp matches because the substring
131 S<C<'o W'> > occurs in the string S<C<"Hello World"> >. The space
132 character ' ' is treated like any other character in a regexp and is
133 needed to match in this case. The lack of a space character is the
134 reason the third regexp C<'oW'> doesn't match. The fourth regexp
135 C<'World '> doesn't match because there is a space at the end of the
136 regexp, but not at the end of the string. The lesson here is that
137 regexps must match a part of the string I<exactly> in order for the
138 statement to be true.
140 If a regexp matches in more than one place in the string, perl will
141 always match at the earliest possible point in the string:
143 "Hello World" =~ /o/; # matches 'o' in 'Hello'
144 "That hat is red" =~ /hat/; # matches 'hat' in 'That'
146 With respect to character matching, there are a few more points you
147 need to know about. First of all, not all characters can be used 'as
148 is' in a match. Some characters, called B<metacharacters>, are reserved
149 for use in regexp notation. The metacharacters are
153 The significance of each of these will be explained
154 in the rest of the tutorial, but for now, it is important only to know
155 that a metacharacter can be matched by putting a backslash before it:
157 "2+2=4" =~ /2+2/; # doesn't match, + is a metacharacter
158 "2+2=4" =~ /2\+2/; # matches, \+ is treated like an ordinary +
159 "The interval is [0,1)." =~ /[0,1)./ # is a syntax error!
160 "The interval is [0,1)." =~ /\[0,1\)\./ # matches
161 "/usr/bin/perl" =~ /\/usr\/local\/bin\/perl/; # matches
163 In the last regexp, the forward slash C<'/'> is also backslashed,
164 because it is used to delimit the regexp. This can lead to LTS
165 (leaning toothpick syndrome), however, and it is often more readable
166 to change delimiters.
169 The backslash character C<'\'> is a metacharacter itself and needs to
172 'C:\WIN32' =~ /C:\\WIN/; # matches
174 In addition to the metacharacters, there are some ASCII characters
175 which don't have printable character equivalents and are instead
176 represented by B<escape sequences>. Common examples are C<\t> for a
177 tab, C<\n> for a newline, C<\r> for a carriage return and C<\a> for a
178 bell. If your string is better thought of as a sequence of arbitrary
179 bytes, the octal escape sequence, e.g., C<\033>, or hexadecimal escape
180 sequence, e.g., C<\x1B> may be a more natural representation for your
181 bytes. Here are some examples of escapes:
183 "1000\t2000" =~ m(0\t2) # matches
184 "1000\n2000" =~ /0\n20/ # matches
185 "1000\t2000" =~ /\000\t2/ # doesn't match, "0" ne "\000"
186 "cat" =~ /\143\x61\x74/ # matches, but a weird way to spell cat
188 If you've been around Perl a while, all this talk of escape sequences
189 may seem familiar. Similar escape sequences are used in double-quoted
190 strings and in fact the regexps in Perl are mostly treated as
191 double-quoted strings. This means that variables can be used in
192 regexps as well. Just like double-quoted strings, the values of the
193 variables in the regexp will be substituted in before the regexp is
194 evaluated for matching purposes. So we have:
197 'housecat' =~ /$foo/; # matches
198 'cathouse' =~ /cat$foo/; # matches
199 'housecat' =~ /${foo}cat/; # matches
201 So far, so good. With the knowledge above you can already perform
202 searches with just about any literal string regexp you can dream up.
203 Here is a I<very simple> emulation of the Unix grep program:
213 % chmod +x simple_grep
215 % simple_grep abba /usr/dict/words
226 This program is easy to understand. C<#!/usr/bin/perl> is the standard
227 way to invoke a perl program from the shell.
228 S<C<$regexp = shift;> > saves the first command line argument as the
229 regexp to be used, leaving the rest of the command line arguments to
230 be treated as files. S<C<< while (<>) >> > loops over all the lines in
231 all the files. For each line, S<C<print if /$regexp/;> > prints the
232 line if the regexp matches the line. In this line, both C<print> and
233 C</$regexp/> use the default variable C<$_> implicitly.
235 With all of the regexps above, if the regexp matched anywhere in the
236 string, it was considered a match. Sometimes, however, we'd like to
237 specify I<where> in the string the regexp should try to match. To do
238 this, we would use the B<anchor> metacharacters C<^> and C<$>. The
239 anchor C<^> means match at the beginning of the string and the anchor
240 C<$> means match at the end of the string, or before a newline at the
241 end of the string. Here is how they are used:
243 "housekeeper" =~ /keeper/; # matches
244 "housekeeper" =~ /^keeper/; # doesn't match
245 "housekeeper" =~ /keeper$/; # matches
246 "housekeeper\n" =~ /keeper$/; # matches
248 The second regexp doesn't match because C<^> constrains C<keeper> to
249 match only at the beginning of the string, but C<"housekeeper"> has
250 keeper starting in the middle. The third regexp does match, since the
251 C<$> constrains C<keeper> to match only at the end of the string.
253 When both C<^> and C<$> are used at the same time, the regexp has to
254 match both the beginning and the end of the string, i.e., the regexp
255 matches the whole string. Consider
257 "keeper" =~ /^keep$/; # doesn't match
258 "keeper" =~ /^keeper$/; # matches
259 "" =~ /^$/; # ^$ matches an empty string
261 The first regexp doesn't match because the string has more to it than
262 C<keep>. Since the second regexp is exactly the string, it
263 matches. Using both C<^> and C<$> in a regexp forces the complete
264 string to match, so it gives you complete control over which strings
265 match and which don't. Suppose you are looking for a fellow named
266 bert, off in a string by himself:
268 "dogbert" =~ /bert/; # matches, but not what you want
270 "dilbert" =~ /^bert/; # doesn't match, but ..
271 "bertram" =~ /^bert/; # matches, so still not good enough
273 "bertram" =~ /^bert$/; # doesn't match, good
274 "dilbert" =~ /^bert$/; # doesn't match, good
275 "bert" =~ /^bert$/; # matches, perfect
277 Of course, in the case of a literal string, one could just as easily
278 use the string equivalence S<C<$string eq 'bert'> > and it would be
279 more efficient. The C<^...$> regexp really becomes useful when we
280 add in the more powerful regexp tools below.
282 =head2 Using character classes
284 Although one can already do quite a lot with the literal string
285 regexps above, we've only scratched the surface of regular expression
286 technology. In this and subsequent sections we will introduce regexp
287 concepts (and associated metacharacter notations) that will allow a
288 regexp to not just represent a single character sequence, but a I<whole
291 One such concept is that of a B<character class>. A character class
292 allows a set of possible characters, rather than just a single
293 character, to match at a particular point in a regexp. Character
294 classes are denoted by brackets C<[...]>, with the set of characters
295 to be possibly matched inside. Here are some examples:
297 /cat/; # matches 'cat'
298 /[bcr]at/; # matches 'bat, 'cat', or 'rat'
299 /item[0123456789]/; # matches 'item0' or ... or 'item9'
300 "abc" =~ /[cab]/; # matches 'a'
302 In the last statement, even though C<'c'> is the first character in
303 the class, C<'a'> matches because the first character position in the
304 string is the earliest point at which the regexp can match.
306 /[yY][eE][sS]/; # match 'yes' in a case-insensitive way
307 # 'yes', 'Yes', 'YES', etc.
309 This regexp displays a common task: perform a a case-insensitive
310 match. Perl provides away of avoiding all those brackets by simply
311 appending an C<'i'> to the end of the match. Then C</[yY][eE][sS]/;>
312 can be rewritten as C</yes/i;>. The C<'i'> stands for
313 case-insensitive and is an example of a B<modifier> of the matching
314 operation. We will meet other modifiers later in the tutorial.
316 We saw in the section above that there were ordinary characters, which
317 represented themselves, and special characters, which needed a
318 backslash C<\> to represent themselves. The same is true in a
319 character class, but the sets of ordinary and special characters
320 inside a character class are different than those outside a character
321 class. The special characters for a character class are C<-]\^$>. C<]>
322 is special because it denotes the end of a character class. C<$> is
323 special because it denotes a scalar variable. C<\> is special because
324 it is used in escape sequences, just like above. Here is how the
325 special characters C<]$\> are handled:
327 /[\]c]def/; # matches ']def' or 'cdef'
329 /[$x]at/; # matches 'bat', 'cat', or 'rat'
330 /[\$x]at/; # matches '$at' or 'xat'
331 /[\\$x]at/; # matches '\at', 'bat, 'cat', or 'rat'
333 The last two are a little tricky. in C<[\$x]>, the backslash protects
334 the dollar sign, so the character class has two members C<$> and C<x>.
335 In C<[\\$x]>, the backslash is protected, so C<$x> is treated as a
336 variable and substituted in double quote fashion.
338 The special character C<'-'> acts as a range operator within character
339 classes, so that a contiguous set of characters can be written as a
340 range. With ranges, the unwieldy C<[0123456789]> and C<[abc...xyz]>
341 become the svelte C<[0-9]> and C<[a-z]>. Some examples are
343 /item[0-9]/; # matches 'item0' or ... or 'item9'
344 /[0-9bx-z]aa/; # matches '0aa', ..., '9aa',
345 # 'baa', 'xaa', 'yaa', or 'zaa'
346 /[0-9a-fA-F]/; # matches a hexadecimal digit
347 /[0-9a-zA-Z_]/; # matches a "word" character,
348 # like those in a perl variable name
350 If C<'-'> is the first or last character in a character class, it is
351 treated as an ordinary character; C<[-ab]>, C<[ab-]> and C<[a\-b]> are
354 The special character C<^> in the first position of a character class
355 denotes a B<negated character class>, which matches any character but
356 those in the brackets. Both C<[...]> and C<[^...]> must match a
357 character, or the match fails. Then
359 /[^a]at/; # doesn't match 'aat' or 'at', but matches
360 # all other 'bat', 'cat, '0at', '%at', etc.
361 /[^0-9]/; # matches a non-numeric character
362 /[a^]at/; # matches 'aat' or '^at'; here '^' is ordinary
364 Now, even C<[0-9]> can be a bother the write multiple times, so in the
365 interest of saving keystrokes and making regexps more readable, Perl
366 has several abbreviations for common character classes:
371 \d is a digit and represents [0-9]
374 \s is a whitespace character and represents [\ \t\r\n\f]
377 \w is a word character (alphanumeric or _) and represents [0-9a-zA-Z_]
380 \D is a negated \d; it represents any character but a digit [^0-9]
383 \S is a negated \s; it represents any non-whitespace character [^\s]
386 \W is a negated \w; it represents any non-word character [^\w]
389 The period '.' matches any character but "\n"
393 The C<\d\s\w\D\S\W> abbreviations can be used both inside and outside
394 of character classes. Here are some in use:
396 /\d\d:\d\d:\d\d/; # matches a hh:mm:ss time format
397 /[\d\s]/; # matches any digit or whitespace character
398 /\w\W\w/; # matches a word char, followed by a
399 # non-word char, followed by a word char
400 /..rt/; # matches any two chars, followed by 'rt'
401 /end\./; # matches 'end.'
402 /end[.]/; # same thing, matches 'end.'
404 Because a period is a metacharacter, it needs to be escaped to match
405 as an ordinary period. Because, for example, C<\d> and C<\w> are sets
406 of characters, it is incorrect to think of C<[^\d\w]> as C<[\D\W]>; in
407 fact C<[^\d\w]> is the same as C<[^\w]>, which is the same as
408 C<[\W]>. Think DeMorgan's laws.
410 An anchor useful in basic regexps is the S<B<word anchor> >
411 C<\b>. This matches a boundary between a word character and a non-word
412 character C<\w\W> or C<\W\w>:
414 $x = "Housecat catenates house and cat";
415 $x =~ /cat/; # matches cat in 'housecat'
416 $x =~ /\bcat/; # matches cat in 'catenates'
417 $x =~ /cat\b/; # matches cat in 'housecat'
418 $x =~ /\bcat\b/; # matches 'cat' at end of string
420 Note in the last example, the end of the string is considered a word
423 You might wonder why C<'.'> matches everything but C<"\n"> - why not
424 every character? The reason is that often one is matching against
425 lines and would like to ignore the newline characters. For instance,
426 while the string C<"\n"> represents one line, we would like to think
429 "" =~ /^$/; # matches
430 "\n" =~ /^$/; # matches, "\n" is ignored
432 "" =~ /./; # doesn't match; it needs a char
433 "" =~ /^.$/; # doesn't match; it needs a char
434 "\n" =~ /^.$/; # doesn't match; it needs a char other than "\n"
435 "a" =~ /^.$/; # matches
436 "a\n" =~ /^.$/; # matches, ignores the "\n"
438 This behavior is convenient, because we usually want to ignore
439 newlines when we count and match characters in a line. Sometimes,
440 however, we want to keep track of newlines. We might even want C<^>
441 and C<$> to anchor at the beginning and end of lines within the
442 string, rather than just the beginning and end of the string. Perl
443 allows us to choose between ignoring and paying attention to newlines
444 by using the C<//s> and C<//m> modifiers. C<//s> and C<//m> stand for
445 single line and multi-line and they determine whether a string is to
446 be treated as one continuous string, or as a set of lines. The two
447 modifiers affect two aspects of how the regexp is interpreted: 1) how
448 the C<'.'> character class is defined, and 2) where the anchors C<^>
449 and C<$> are able to match. Here are the four possible combinations:
454 no modifiers (//): Default behavior. C<'.'> matches any character
455 except C<"\n">. C<^> matches only at the beginning of the string and
456 C<$> matches only at the end or before a newline at the end.
459 s modifier (//s): Treat string as a single long line. C<'.'> matches
460 any character, even C<"\n">. C<^> matches only at the beginning of
461 the string and C<$> matches only at the end or before a newline at the
465 m modifier (//m): Treat string as a set of multiple lines. C<'.'>
466 matches any character except C<"\n">. C<^> and C<$> are able to match
467 at the start or end of I<any> line within the string.
470 both s and m modifiers (//sm): Treat string as a single long line, but
471 detect multiple lines. C<'.'> matches any character, even
472 C<"\n">. C<^> and C<$>, however, are able to match at the start or end
473 of I<any> line within the string.
477 Here are examples of C<//s> and C<//m> in action:
479 $x = "There once was a girl\nWho programmed in Perl\n";
481 $x =~ /^Who/; # doesn't match, "Who" not at start of string
482 $x =~ /^Who/s; # doesn't match, "Who" not at start of string
483 $x =~ /^Who/m; # matches, "Who" at start of second line
484 $x =~ /^Who/sm; # matches, "Who" at start of second line
486 $x =~ /girl.Who/; # doesn't match, "." doesn't match "\n"
487 $x =~ /girl.Who/s; # matches, "." matches "\n"
488 $x =~ /girl.Who/m; # doesn't match, "." doesn't match "\n"
489 $x =~ /girl.Who/sm; # matches, "." matches "\n"
491 Most of the time, the default behavior is what is want, but C<//s> and
492 C<//m> are occasionally very useful. If C<//m> is being used, the start
493 of the string can still be matched with C<\A> and the end of string
494 can still be matched with the anchors C<\Z> (matches both the end and
495 the newline before, like C<$>), and C<\z> (matches only the end):
497 $x =~ /^Who/m; # matches, "Who" at start of second line
498 $x =~ /\AWho/m; # doesn't match, "Who" is not at start of string
500 $x =~ /girl$/m; # matches, "girl" at end of first line
501 $x =~ /girl\Z/m; # doesn't match, "girl" is not at end of string
503 $x =~ /Perl\Z/m; # matches, "Perl" is at newline before end
504 $x =~ /Perl\z/m; # doesn't match, "Perl" is not at end of string
506 We now know how to create choices among classes of characters in a
507 regexp. What about choices among words or character strings? Such
508 choices are described in the next section.
510 =head2 Matching this or that
512 Sometimes we would like to our regexp to be able to match different
513 possible words or character strings. This is accomplished by using
514 the B<alternation> metacharacter C<|>. To match C<dog> or C<cat>, we
515 form the regexp C<dog|cat>. As before, perl will try to match the
516 regexp at the earliest possible point in the string. At each
517 character position, perl will first try to match the first
518 alternative, C<dog>. If C<dog> doesn't match, perl will then try the
519 next alternative, C<cat>. If C<cat> doesn't match either, then the
520 match fails and perl moves to the next position in the string. Some
523 "cats and dogs" =~ /cat|dog|bird/; # matches "cat"
524 "cats and dogs" =~ /dog|cat|bird/; # matches "cat"
526 Even though C<dog> is the first alternative in the second regexp,
527 C<cat> is able to match earlier in the string.
529 "cats" =~ /c|ca|cat|cats/; # matches "c"
530 "cats" =~ /cats|cat|ca|c/; # matches "cats"
532 Here, all the alternatives match at the first string position, so the
533 first alternative is the one that matches. If some of the
534 alternatives are truncations of the others, put the longest ones first
535 to give them a chance to match.
537 "cab" =~ /a|b|c/ # matches "c"
540 The last example points out that character classes are like
541 alternations of characters. At a given character position, the first
542 alternative that allows the regexp match to succeed wil be the one
545 =head2 Grouping things and hierarchical matching
547 Alternation allows a regexp to choose among alternatives, but by
548 itself it unsatisfying. The reason is that each alternative is a whole
549 regexp, but sometime we want alternatives for just part of a
550 regexp. For instance, suppose we want to search for housecats or
551 housekeepers. The regexp C<housecat|housekeeper> fits the bill, but is
552 inefficient because we had to type C<house> twice. It would be nice to
553 have parts of the regexp be constant, like C<house>, and and some
554 parts have alternatives, like C<cat|keeper>.
556 The B<grouping> metacharacters C<()> solve this problem. Grouping
557 allows parts of a regexp to be treated as a single unit. Parts of a
558 regexp are grouped by enclosing them in parentheses. Thus we could solve
559 the C<housecat|housekeeper> by forming the regexp as
560 C<house(cat|keeper)>. The regexp C<house(cat|keeper)> means match
561 C<house> followed by either C<cat> or C<keeper>. Some more examples
564 /(a|b)b/; # matches 'ab' or 'bb'
565 /(ac|b)b/; # matches 'acb' or 'bb'
566 /(^a|b)c/; # matches 'ac' at start of string or 'bc' anywhere
567 /(a|[bc])d/; # matches 'ad', 'bd', or 'cd'
569 /house(cat|)/; # matches either 'housecat' or 'house'
570 /house(cat(s|)|)/; # matches either 'housecats' or 'housecat' or
571 # 'house'. Note groups can be nested.
573 /(19|20|)\d\d/; # match years 19xx, 20xx, or the Y2K problem, xx
574 "20" =~ /(19|20|)\d\d/; # matches the null alternative '()\d\d',
575 # because '20\d\d' can't match
577 Alternations behave the same way in groups as out of them: at a given
578 string position, the leftmost alternative that allows the regexp to
579 match is taken. So in the last example at tth first string position,
580 C<"20"> matches the second alternative, but there is nothing left over
581 to match the next two digits C<\d\d>. So perl moves on to the next
582 alternative, which is the null alternative and that works, since
583 C<"20"> is two digits.
585 The process of trying one alternative, seeing if it matches, and
586 moving on to the next alternative if it doesn't, is called
587 B<backtracking>. The term 'backtracking' comes from the idea that
588 matching a regexp is like a walk in the woods. Successfully matching
589 a regexp is like arriving at a destination. There are many possible
590 trailheads, one for each string position, and each one is tried in
591 order, left to right. From each trailhead there may be many paths,
592 some of which get you there, and some which are dead ends. When you
593 walk along a trail and hit a dead end, you have to backtrack along the
594 trail to an earlier point to try another trail. If you hit your
595 destination, you stop immediately and forget about trying all the
596 other trails. You are persistent, and only if you have tried all the
597 trails from all the trailheads and not arrived at your destination, do
598 you declare failure. To be concrete, here is a step-by-step analysis
599 of what perl does when it tries to match the regexp
601 "abcde" =~ /(abd|abc)(df|d|de)/;
605 =item 0 Start with the first letter in the string 'a'.
607 =item 1 Try the first alternative in the first group 'abd'.
609 =item 2 Match 'a' followed by 'b'. So far so good.
611 =item 3 'd' in the regexp doesn't match 'c' in the string - a dead
612 end. So backtrack two characters and pick the second alternative in
613 the first group 'abc'.
615 =item 4 Match 'a' followed by 'b' followed by 'c'. We are on a roll
616 and have satisfied the first group. Set $1 to 'abc'.
618 =item 5 Move on to the second group and pick the first alternative
621 =item 6 Match the 'd'.
623 =item 7 'f' in the regexp doesn't match 'e' in the string, so a dead
624 end. Backtrack one character and pick the second alternative in the
627 =item 8 'd' matches. The second grouping is satisfied, so set $2 to
630 =item 9 We are at the end of the regexp, so we are done! We have
631 matched 'abcd' out of the string "abcde".
635 There are a couple of things to note about this analysis. First, the
636 third alternative in the second group 'de' also allows a match, but we
637 stopped before we got to it - at a given character position, leftmost
638 wins. Second, we were able to get a match at the first character
639 position of the string 'a'. If there were no matches at the first
640 position, perl would move to the second character position 'b' and
641 attempt the match all over again. Only when all possible paths at all
642 possible character positions have been exhausted does perl give give
643 up and declare S<C<$string =~ /(abd|abc)(df|d|de)/;> > to be false.
645 Even with all this work, regexp matching happens remarkably fast. To
646 speed things up, during compilation stage, perl compiles the regexp
647 into a compact sequence of opcodes that can often fit inside a
648 processor cache. When the code is executed, these opcodes can then run
649 at full throttle and search very quickly.
651 =head2 Extracting matches
653 The grouping metacharacters C<()> also serve another completely
654 different function: they allow the extraction of the parts of a string
655 that matched. This is very useful to find out what matched and for
656 text processing in general. For each grouping, the part that matched
657 inside goes into the special variables C<$1>, C<$2>, etc. They can be
658 used just as ordinary variables:
660 # extract hours, minutes, seconds
661 $time =~ /(\d\d):(\d\d):(\d\d)/; # match hh:mm:ss format
666 Now, we know that in scalar context,
667 S<C<$time =~ /(\d\d):(\d\d):(\d\d)/> > returns a true or false
668 value. In list context, however, it returns the list of matched values
669 C<($1,$2,$3)>. So we could write the code more compactly as
671 # extract hours, minutes, seconds
672 ($hours, $minutes, $second) = ($time =~ /(\d\d):(\d\d):(\d\d)/);
674 If the groupings in a regexp are nested, C<$1> gets the group with the
675 leftmost opening parenthesis, C<$2> the next opening parenthesis,
676 etc. For example, here is a complex regexp and the matching variables
679 /(ab(cd|ef)((gi)|j))/;
682 so that if the regexp matched, e.g., C<$2> would contain 'cd' or 'ef'.
683 For convenience, perl sets C<$+> to the highest numbered C<$1>, C<$2>,
684 ... that got assigned.
686 Closely associated with the matching variables C<$1>, C<$2>, ... are
687 the B<backreferences> C<\1>, C<\2>, ... . Backreferences are simply
688 matching variables that can be used I<inside> a regexp. This is a
689 really nice feature - what matches later in a regexp can depend on
690 what matched earlier in the regexp. Suppose we wanted to look
691 for doubled words in text, like 'the the'. The following regexp finds
692 all 3-letter doubles with a space in between:
696 The grouping assigns a value to \1, so that the same 3 letter sequence
697 is used for both parts. Here are some words with repeated parts:
699 % simple_grep '^(\w\w\w\w|\w\w\w|\w\w|\w)\1$' /usr/dict/words
707 The regexp has a single grouping which considers 4-letter
708 combinations, then 3-letter combinations, etc. and uses C<\1> to look for
709 a repeat. Although C<$1> and C<\1> represent the same thing, care should be
710 taken to use matched variables C<$1>, C<$2>, ... only outside a regexp
711 and backreferences C<\1>, C<\2>, ... only inside a regexp; not doing
712 so may lead to surprising and/or undefined results.
714 In addition to what was matched, Perl 5.6.0 also provides the
715 positions of what was matched with the C<@-> and C<@+>
716 arrays. C<$-[0]> is the position of the start of the entire match and
717 C<$+[0]> is the position of the end. Similarly, C<$-[n]> is the
718 position of the start of the C<$n> match and C<$+[n]> is the position
719 of the end. If C<$n> is undefined, so are C<$-[n]> and C<$+[n]>. Then
722 $x = "Mmm...donut, thought Homer";
723 $x =~ /^(Mmm|Yech)\.\.\.(donut|peas)/; # matches
724 foreach $expr (1..$#-) {
725 print "Match $expr: '${$expr}' at position ($-[$expr],$+[$expr])\n";
730 Match 1: 'Mmm' at position (0,3)
731 Match 2: 'donut' at position (6,11)
733 Even if there are no groupings in a regexp, it is still possible to
734 find out what exactly matched in a string. If you use them, perl
735 will set C<$`> to the part of the string before the match, will set C<$&>
736 to the part of the string that matched, and will set C<$'> to the part
737 of the string after the match. An example:
739 $x = "the cat caught the mouse";
740 $x =~ /cat/; # $` = 'the ', $& = 'cat', $' = ' caught the mouse'
741 $x =~ /the/; # $` = '', $& = 'the', $' = ' cat caught the mouse'
743 In the second match, S<C<$` = ''> > because the regexp matched at the
744 first character position in the string and stopped, it never saw the
745 second 'the'. It is important to note that using C<$`> and C<$'>
746 slows down regexp matching quite a bit, and C< $& > slows it down to a
747 lesser extent, because if they are used in one regexp in a program,
748 they are generated for <all> regexps in the program. So if raw
749 performance is a goal of your application, they should be avoided.
750 If you need them, use C<@-> and C<@+> instead:
752 $` is the same as substr( $x, 0, $-[0] )
753 $& is the same as substr( $x, $-[0], $+[0]-$-[0] )
754 $' is the same as substr( $x, $+[0] )
756 =head2 Matching repetitions
758 The examples in the previous section display an annoying weakness. We
759 were only matching 3-letter words, or syllables of 4 letters or
760 less. We'd like to be able to match words or syllables of any length,
761 without writing out tedious alternatives like
762 C<\w\w\w\w|\w\w\w|\w\w|\w>.
764 This is exactly the problem the B<quantifier> metacharacters C<?>,
765 C<*>, C<+>, and C<{}> were created for. They allow us to determine the
766 number of repeats of a portion of a regexp we consider to be a
767 match. Quantifiers are put immediately after the character, character
768 class, or grouping that we want to specify. They have the following
773 =item * C<a?> = match 'a' 1 or 0 times
775 =item * C<a*> = match 'a' 0 or more times, i.e., any number of times
777 =item * C<a+> = match 'a' 1 or more times, i.e., at least once
779 =item * C<a{n,m}> = match at least C<n> times, but not more than C<m>
782 =item * C<a{n,}> = match at least C<n> or more times
784 =item * C<a{n}> = match exactly C<n> times
788 Here are some examples:
790 /[a-z]+\s+\d*/; # match a lowercase word, at least some space, and
791 # any number of digits
792 /(\w+)\s+\1/; # match doubled words of arbitrary length
793 /y(es)?/i; # matches 'y', 'Y', or a case-insensitive 'yes'
794 $year =~ /\d{2,4}/; # make sure year is at least 2 but not more
796 $year =~ /\d{4}|\d{2}/; # better match; throw out 3 digit dates
797 $year =~ /\d{2}(\d{2})?/; # same thing written differently. However,
798 # this produces $1 and the other does not.
800 % simple_grep '^(\w+)\1$' /usr/dict/words # isn't this easier?
808 For all of these quantifiers, perl will try to match as much of the
809 string as possible, while still allowing the regexp to succeed. Thus
810 with C</a?.../>, perl will first try to match the regexp with the C<a>
811 present; if that fails, perl will try to match the regexp without the
812 C<a> present. For the quantifier C<*>, we get the following:
814 $x = "the cat in the hat";
815 $x =~ /^(.*)(cat)(.*)$/; # matches,
820 Which is what we might expect, the match finds the only C<cat> in the
821 string and locks onto it. Consider, however, this regexp:
823 $x =~ /^(.*)(at)(.*)$/; # matches,
824 # $1 = 'the cat in the h'
826 # $3 = '' (0 matches)
828 One might initially guess that perl would find the C<at> in C<cat> and
829 stop there, but that wouldn't give the longest possible string to the
830 first quantifier C<.*>. Instead, the first quantifier C<.*> grabs as
831 much of the string as possible while still having the regexp match. In
832 this example, that means having the C<at> sequence with the final C<at>
833 in the string. The other important principle illustrated here is that
834 when there are two or more elements in a regexp, the I<leftmost>
835 quantifier, if there is one, gets to grab as much the string as
836 possible, leaving the rest of the regexp to fight over scraps. Thus in
837 our example, the first quantifier C<.*> grabs most of the string, while
838 the second quantifier C<.*> gets the empty string. Quantifiers that
839 grab as much of the string as possible are called B<maximal match> or
840 B<greedy> quantifiers.
842 When a regexp can match a string in several different ways, we can use
843 the principles above to predict which way the regexp will match:
848 Principle 0: Taken as a whole, any regexp will be matched at the
849 earliest possible position in the string.
852 Principle 1: In an alternation C<a|b|c...>, the leftmost alternative
853 that allows a match for the whole regexp will be the one used.
856 Principle 2: The maximal matching quantifiers C<?>, C<*>, C<+> and
857 C<{n,m}> will in general match as much of the string as possible while
858 still allowing the whole regexp to match.
861 Principle 3: If there are two or more elements in a regexp, the
862 leftmost greedy quantifier, if any, will match as much of the string
863 as possible while still allowing the whole regexp to match. The next
864 leftmost greedy quantifier, if any, will try to match as much of the
865 string remaining available to it as possible, while still allowing the
866 whole regexp to match. And so on, until all the regexp elements are
871 As we have seen above, Principle 0 overrides the others - the regexp
872 will be matched as early as possible, with the other principles
873 determining how the regexp matches at that earliest character
876 Here is an example of these principles in action:
878 $x = "The programming republic of Perl";
879 $x =~ /^(.+)(e|r)(.*)$/; # matches,
880 # $1 = 'The programming republic of Pe'
884 This regexp matches at the earliest string position, C<'T'>. One
885 might think that C<e>, being leftmost in the alternation, would be
886 matched, but C<r> produces the longest string in the first quantifier.
888 $x =~ /(m{1,2})(.*)$/; # matches,
890 # $2 = 'ing republic of Perl'
892 Here, The earliest possible match is at the first C<'m'> in
893 C<programming>. C<m{1,2}> is the first quantifier, so it gets to match
896 $x =~ /.*(m{1,2})(.*)$/; # matches,
898 # $2 = 'ing republic of Perl'
900 Here, the regexp matches at the start of the string. The first
901 quantifier C<.*> grabs as much as possible, leaving just a single
902 C<'m'> for the second quantifier C<m{1,2}>.
904 $x =~ /(.?)(m{1,2})(.*)$/; # matches,
907 # $3 = 'ing republic of Perl'
909 Here, C<.?> eats its maximal one character at the earliest possible
910 position in the string, C<'a'> in C<programming>, leaving C<m{1,2}>
911 the opportunity to match both C<m>'s. Finally,
913 "aXXXb" =~ /(X*)/; # matches with $1 = ''
915 because it can match zero copies of C<'X'> at the beginning of the
916 string. If you definitely want to match at least one C<'X'>, use
919 Sometimes greed is not good. At times, we would like quantifiers to
920 match a I<minimal> piece of string, rather than a maximal piece. For
921 this purpose, Larry Wall created the S<B<minimal match> > or
922 B<non-greedy> quantifiers C<??>,C<*?>, C<+?>, and C<{}?>. These are
923 the usual quantifiers with a C<?> appended to them. They have the
928 =item * C<a??> = match 'a' 0 or 1 times. Try 0 first, then 1.
930 =item * C<a*?> = match 'a' 0 or more times, i.e., any number of times,
931 but as few times as possible
933 =item * C<a+?> = match 'a' 1 or more times, i.e., at least once, but
934 as few times as possible
936 =item * C<a{n,m}?> = match at least C<n> times, not more than C<m>
937 times, as few times as possible
939 =item * C<a{n,}?> = match at least C<n> times, but as few times as
942 =item * C<a{n}?> = match exactly C<n> times. Because we match exactly
943 C<n> times, C<a{n}?> is equivalent to C<a{n}> and is just there for
944 notational consistency.
948 Let's look at the example above, but with minimal quantifiers:
950 $x = "The programming republic of Perl";
951 $x =~ /^(.+?)(e|r)(.*)$/; # matches,
954 # $3 = ' programming republic of Perl'
956 The minimal string that will allow both the start of the string C<^>
957 and the alternation to match is C<Th>, with the alternation C<e|r>
958 matching C<e>. The second quantifier C<.*> is free to gobble up the
961 $x =~ /(m{1,2}?)(.*?)$/; # matches,
963 # $2 = 'ming republic of Perl'
965 The first string position that this regexp can match is at the first
966 C<'m'> in C<programming>. At this position, the minimal C<m{1,2}?>
967 matches just one C<'m'>. Although the second quantifier C<.*?> would
968 prefer to match no characters, it is constrained by the end-of-string
969 anchor C<$> to match the rest of the string.
971 $x =~ /(.*?)(m{1,2}?)(.*)$/; # matches,
974 # $3 = 'ming republic of Perl'
976 In this regexp, you might expect the first minimal quantifier C<.*?>
977 to match the empty string, because it is not constrained by a C<^>
978 anchor to match the beginning of the word. Principle 0 applies here,
979 however. Because it is possible for the whole regexp to match at the
980 start of the string, it I<will> match at the start of the string. Thus
981 the first quantifier has to match everything up to the first C<m>. The
982 second minimal quantifier matches just one C<m> and the third
983 quantifier matches the rest of the string.
985 $x =~ /(.??)(m{1,2})(.*)$/; # matches,
988 # $3 = 'ing republic of Perl'
990 Just as in the previous regexp, the first quantifier C<.??> can match
991 earliest at position C<'a'>, so it does. The second quantifier is
992 greedy, so it matches C<mm>, and the third matches the rest of the
995 We can modify principle 3 above to take into account non-greedy
1001 Principle 3: If there are two or more elements in a regexp, the
1002 leftmost greedy (non-greedy) quantifier, if any, will match as much
1003 (little) of the string as possible while still allowing the whole
1004 regexp to match. The next leftmost greedy (non-greedy) quantifier, if
1005 any, will try to match as much (little) of the string remaining
1006 available to it as possible, while still allowing the whole regexp to
1007 match. And so on, until all the regexp elements are satisfied.
1011 Just like alternation, quantifiers are also susceptible to
1012 backtracking. Here is a step-by-step analysis of the example
1014 $x = "the cat in the hat";
1015 $x =~ /^(.*)(at)(.*)$/; # matches,
1016 # $1 = 'the cat in the h'
1018 # $3 = '' (0 matches)
1022 =item 0 Start with the first letter in the string 't'.
1024 =item 1 The first quantifier '.*' starts out by matching the whole
1025 string 'the cat in the hat'.
1027 =item 2 'a' in the regexp element 'at' doesn't match the end of the
1028 string. Backtrack one character.
1030 =item 3 'a' in the regexp element 'at' still doesn't match the last
1031 letter of the string 't', so backtrack one more character.
1033 =item 4 Now we can match the 'a' and the 't'.
1035 =item 5 Move on to the third element '.*'. Since we are at the end of
1036 the string and '.*' can match 0 times, assign it the empty string.
1038 =item 6 We are done!
1042 Most of the time, all this moving forward and backtracking happens
1043 quickly and searching is fast. There are some pathological regexps,
1044 however, whose execution time exponentially grows with the size of the
1045 string. A typical structure that blows up in your face is of the form
1049 The problem is the nested indeterminate quantifiers. There are many
1050 different ways of partitioning a string of length n between the C<+>
1051 and C<*>: one repetition with C<b+> of length n, two repetitions with
1052 the first C<b+> length k and the second with length n-k, m repetitions
1053 whose bits add up to length n, etc. In fact there are an exponential
1054 number of ways to partition a string as a function of length. A
1055 regexp may get lucky and match early in the process, but if there is
1056 no match, perl will try I<every> possibility before giving up. So be
1057 careful with nested C<*>'s, C<{n,m}>'s, and C<+>'s. The book
1058 I<Mastering regular expressions> by Jeffrey Friedl gives a wonderful
1059 discussion of this and other efficiency issues.
1061 =head2 Building a regexp
1063 At this point, we have all the basic regexp concepts covered, so let's
1064 give a more involved example of a regular expression. We will build a
1065 regexp that matches numbers.
1067 The first task in building a regexp is to decide what we want to match
1068 and what we want to exclude. In our case, we want to match both
1069 integers and floating point numbers and we want to reject any string
1070 that isn't a number.
1072 The next task is to break the problem down into smaller problems that
1073 are easily converted into a regexp.
1075 The simplest case is integers. These consist of a sequence of digits,
1076 with an optional sign in front. The digits we can represent with
1077 C<\d+> and the sign can be matched with C<[+-]>. Thus the integer
1080 /[+-]?\d+/; # matches integers
1082 A floating point number potentially has a sign, an integral part, a
1083 decimal point, a fractional part, and an exponent. One or more of these
1084 parts is optional, so we need to check out the different
1085 possibilities. Floating point numbers which are in proper form include
1086 123., 0.345, .34, -1e6, and 25.4E-72. As with integers, the sign out
1087 front is completely optional and can be matched by C<[+-]?>. We can
1088 see that if there is no exponent, floating point numbers must have a
1089 decimal point, otherwise they are integers. We might be tempted to
1090 model these with C<\d*\.\d*>, but this would also match just a single
1091 decimal point, which is not a number. So the three cases of floating
1092 point number sans exponent are
1094 /[+-]?\d+\./; # 1., 321., etc.
1095 /[+-]?\.\d+/; # .1, .234, etc.
1096 /[+-]?\d+\.\d+/; # 1.0, 30.56, etc.
1098 These can be combined into a single regexp with a three-way alternation:
1100 /[+-]?(\d+\.\d+|\d+\.|\.\d+)/; # floating point, no exponent
1102 In this alternation, it is important to put C<'\d+\.\d+'> before
1103 C<'\d+\.'>. If C<'\d+\.'> were first, the regexp would happily match that
1104 and ignore the fractional part of the number.
1106 Now consider floating point numbers with exponents. The key
1107 observation here is that I<both> integers and numbers with decimal
1108 points are allowed in front of an exponent. Then exponents, like the
1109 overall sign, are independent of whether we are matching numbers with
1110 or without decimal points, and can be 'decoupled' from the
1111 mantissa. The overall form of the regexp now becomes clear:
1113 /^(optional sign)(integer | f.p. mantissa)(optional exponent)$/;
1115 The exponent is an C<e> or C<E>, followed by an integer. So the
1118 /[eE][+-]?\d+/; # exponent
1120 Putting all the parts together, we get a regexp that matches numbers:
1122 /^[+-]?(\d+\.\d+|\d+\.|\.\d+|\d+)([eE][+-]?\d+)?$/; # Ta da!
1124 Long regexps like this may impress your friends, but can be hard to
1125 decipher. In complex situations like this, the C<//x> modifier for a
1126 match is invaluable. It allows one to put nearly arbitrary whitespace
1127 and comments into a regexp without affecting their meaning. Using it,
1128 we can rewrite our 'extended' regexp in the more pleasing form
1131 [+-]? # first, match an optional sign
1132 ( # then match integers or f.p. mantissas:
1133 \d+\.\d+ # mantissa of the form a.b
1134 |\d+\. # mantissa of the form a.
1135 |\.\d+ # mantissa of the form .b
1136 |\d+ # integer of the form a
1138 ([eE][+-]?\d+)? # finally, optionally match an exponent
1141 If whitespace is mostly irrelevant, how does one include space
1142 characters in an extended regexp? The answer is to backslash it
1143 S<C<'\ '> > or put it in a character class S<C<[ ]> >. The same thing
1144 goes for pound signs, use C<\#> or C<[#]>. For instance, Perl allows
1145 a space between the sign and the mantissa/integer, and we could add
1146 this to our regexp as follows:
1149 [+-]?\ * # first, match an optional sign *and space*
1150 ( # then match integers or f.p. mantissas:
1151 \d+\.\d+ # mantissa of the form a.b
1152 |\d+\. # mantissa of the form a.
1153 |\.\d+ # mantissa of the form .b
1154 |\d+ # integer of the form a
1156 ([eE][+-]?\d+)? # finally, optionally match an exponent
1159 In this form, it is easier to see a way to simplify the
1160 alternation. Alternatives 1, 2, and 4 all start with C<\d+>, so it
1161 could be factored out:
1164 [+-]?\ * # first, match an optional sign
1165 ( # then match integers or f.p. mantissas:
1166 \d+ # start out with a ...
1168 \.\d* # mantissa of the form a.b or a.
1169 )? # ? takes care of integers of the form a
1170 |\.\d+ # mantissa of the form .b
1172 ([eE][+-]?\d+)? # finally, optionally match an exponent
1175 or written in the compact form,
1177 /^[+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?$/;
1179 This is our final regexp. To recap, we built a regexp by
1183 =item * specifying the task in detail,
1185 =item * breaking down the problem into smaller parts,
1187 =item * translating the small parts into regexps,
1189 =item * combining the regexps,
1191 =item * and optimizing the final combined regexp.
1195 These are also the typical steps involved in writing a computer
1196 program. This makes perfect sense, because regular expressions are
1197 essentially programs written a little computer language that specifies
1200 =head2 Using regular expressions in Perl
1202 The last topic of Part 1 briefly covers how regexps are used in Perl
1203 programs. Where do they fit into Perl syntax?
1205 We have already introduced the matching operator in its default
1206 C</regexp/> and arbitrary delimiter C<m!regexp!> forms. We have used
1207 the binding operator C<=~> and its negation C<!~> to test for string
1208 matches. Associated with the matching operator, we have discussed the
1209 single line C<//s>, multi-line C<//m>, case-insensitive C<//i> and
1210 extended C<//x> modifiers.
1212 There are a few more things you might want to know about matching
1213 operators. First, we pointed out earlier that variables in regexps are
1214 substituted before the regexp is evaluated:
1218 print if /$pattern/;
1221 This will print any lines containing the word C<Seuss>. It is not as
1222 efficient as it could be, however, because perl has to re-evaluate
1223 C<$pattern> each time through the loop. If C<$pattern> won't be
1224 changing over the lifetime of the script, we can add the C<//o>
1225 modifier, which directs perl to only perform variable substitutions
1229 # Improved simple_grep
1232 print if /$regexp/o; # a good deal faster
1235 If you change C<$pattern> after the first substitution happens, perl
1236 will ignore it. If you don't want any substitutions at all, use the
1237 special delimiter C<m''>:
1241 print if m'$pattern'; # matches '$pattern', not 'Seuss'
1244 C<m''> acts like single quotes on a regexp; all other C<m> delimiters
1245 act like double quotes. If the regexp evaluates to the empty string,
1246 the regexp in the I<last successful match> is used instead. So we have
1248 "dog" =~ /d/; # 'd' matches
1249 "dogbert =~ //; # this matches the 'd' regexp used before
1251 The final two modifiers C<//g> and C<//c> concern multiple matches.
1252 The modifier C<//g> stands for global matching and allows the the
1253 matching operator to match within a string as many times as possible.
1254 In scalar context, successive invocations against a string will have
1255 `C<//g> jump from match to match, keeping track of position in the
1256 string as it goes along. You can get or set the position with the
1259 The use of C<//g> is shown in the following example. Suppose we have
1260 a string that consists of words separated by spaces. If we know how
1261 many words there are in advance, we could extract the words using
1264 $x = "cat dog house"; # 3 words
1265 $x =~ /^\s*(\w+)\s+(\w+)\s+(\w+)\s*$/; # matches,
1270 But what if we had an indeterminate number of words? This is the sort
1271 of task C<//g> was made for. To extract all words, form the simple
1272 regexp C<(\w+)> and loop over all matches with C</(\w+)/g>:
1274 while ($x =~ /(\w+)/g) {
1275 print "Word is $1, ends at position ", pos $x, "\n";
1280 Word is cat, ends at position 3
1281 Word is dog, ends at position 7
1282 Word is house, ends at position 13
1284 A failed match or changing the target string resets the position. If
1285 you don't want the position reset after failure to match, add the
1286 C<//c>, as in C</regexp/gc>. The current position in the string is
1287 associated with the string, not the regexp. This means that different
1288 strings have different positions and their respective positions can be
1289 set or read independently.
1291 In list context, C<//g> returns a list of matched groupings, or if
1292 there are no groupings, a list of matches to the whole regexp. So if
1293 we wanted just the words, we could use
1295 @words = ($x =~ /(\w+)/g); # matches,
1298 # $word[2] = 'house'
1300 Closely associated with the C<//g> modifier is the C<\G> anchor. The
1301 C<\G> anchor matches at the point where the previous C<//g> match left
1302 off. C<\G> allows us to easily do context-sensitive matching:
1304 $metric = 1; # use metric units
1306 $x = <FILE>; # read in measurement
1307 $x =~ /^([+-]?\d+)\s*/g; # get magnitude
1309 if ($metric) { # error checking
1310 print "Units error!" unless $x =~ /\Gkg\./g;
1313 print "Units error!" unless $x =~ /\Glbs\./g;
1315 $x =~ /\G\s+(widget|sprocket)/g; # continue processing
1317 The combination of C<//g> and C<\G> allows us to process the string a
1318 bit at a time and use arbitrary Perl logic to decide what to do next.
1320 C<\G> is also invaluable in processing fixed length records with
1321 regexps. Suppose we have a snippet of coding region DNA, encoded as
1322 base pair letters C<ATCGTTGAAT...> and we want to find all the stop
1323 codons C<TGA>. In a coding region, codons are 3-letter sequences, so
1324 we can think of the DNA snippet as a sequence of 3-letter records. The
1327 # expanded, this is "ATC GTT GAA TGC AAA TGA CAT GAC"
1328 $dna = "ATCGTTGAATGCAAATGACATGAC";
1331 doesn't work; it may match an C<TGA>, but there is no guarantee that
1332 the match is aligned with codon boundaries, e.g., the substring
1333 S<C<GTT GAA> > gives a match. A better solution is
1335 while ($dna =~ /(\w\w\w)*?TGA/g) { # note the minimal *?
1336 print "Got a TGA stop codon at position ", pos $dna, "\n";
1341 Got a TGA stop codon at position 18
1342 Got a TGA stop codon at position 23
1344 Position 18 is good, but position 23 is bogus. What happened?
1346 The answer is that our regexp works well until we get past the last
1347 real match. Then the regexp will fail to match a synchronized C<TGA>
1348 and start stepping ahead one character position at a time, not what we
1349 want. The solution is to use C<\G> to anchor the match to the codon
1352 while ($dna =~ /\G(\w\w\w)*?TGA/g) {
1353 print "Got a TGA stop codon at position ", pos $dna, "\n";
1358 Got a TGA stop codon at position 18
1360 which is the correct answer. This example illustrates that it is
1361 important not only to match what is desired, but to reject what is not
1364 B<search and replace>
1366 Regular expressions also play a big role in B<search and replace>
1367 operations in Perl. Search and replace is accomplished with the
1368 C<s///> operator. The general form is
1369 C<s/regexp/replacement/modifiers>, with everything we know about
1370 regexps and modifiers applying in this case as well. The
1371 C<replacement> is a Perl double quoted string that replaces in the
1372 string whatever is matched with the C<regexp>. The operator C<=~> is
1373 also used here to associate a string with C<s///>. If matching
1374 against C<$_>, the S<C<$_ =~> > can be dropped. If there is a match,
1375 C<s///> returns the number of substitutions made, otherwise it returns
1376 false. Here are a few examples:
1378 $x = "Time to feed the cat!";
1379 $x =~ s/cat/hacker/; # $x contains "Time to feed the hacker!"
1380 if ($x =~ s/^(Time.*hacker)!$/$1 now!/) {
1381 $more_insistent = 1;
1383 $y = "'quoted words'";
1384 $y =~ s/^'(.*)'$/$1/; # strip single quotes,
1385 # $y contains "quoted words"
1387 In the last example, the whole string was matched, but only the part
1388 inside the single quotes was grouped. With the C<s///> operator, the
1389 matched variables C<$1>, C<$2>, etc. are immediately available for use
1390 in the replacement expression, so we use C<$1> to replace the quoted
1391 string with just what was quoted. With the global modifier, C<s///g>
1392 will search and replace all occurrences of the regexp in the string:
1394 $x = "I batted 4 for 4";
1395 $x =~ s/4/four/; # doesn't do it all:
1396 # $x contains "I batted four for 4"
1397 $x = "I batted 4 for 4";
1398 $x =~ s/4/four/g; # does it all:
1399 # $x contains "I batted four for four"
1401 If you prefer 'regex' over 'regexp' in this tutorial, you could use
1402 the following program to replace it:
1404 % cat > simple_replace
1407 $replacement = shift;
1409 s/$regexp/$replacement/go;
1414 % simple_replace regexp regex perlretut.pod
1416 In C<simple_replace> we used the C<s///g> modifier to replace all
1417 occurrences of the regexp on each line and the C<s///o> modifier to
1418 compile the regexp only once. As with C<simple_grep>, both the
1419 C<print> and the C<s/$regexp/$replacement/go> use C<$_> implicitly.
1421 A modifier available specifically to search and replace is the
1422 C<s///e> evaluation modifier. C<s///e> wraps an C<eval{...}> around
1423 the replacement string and the evaluated result is substituted for the
1424 matched substring. C<s///e> is useful if you need to do a bit of
1425 computation in the process of replacing text. This example counts
1426 character frequencies in a line:
1428 $x = "Bill the cat";
1429 $x =~ s/(.)/$chars{$1}++;$1/eg; # final $1 replaces char with itself
1430 print "frequency of '$_' is $chars{$_}\n"
1431 foreach (sort {$chars{$b} <=> $chars{$a}} keys %chars);
1435 frequency of ' ' is 2
1436 frequency of 't' is 2
1437 frequency of 'l' is 2
1438 frequency of 'B' is 1
1439 frequency of 'c' is 1
1440 frequency of 'e' is 1
1441 frequency of 'h' is 1
1442 frequency of 'i' is 1
1443 frequency of 'a' is 1
1445 As with the match C<m//> operator, C<s///> can use other delimiters,
1446 such as C<s!!!> and C<s{}{}>, and even C<s{}//>. If single quotes are
1447 used C<s'''>, then the regexp and replacement are treated as single
1448 quoted strings and there are no substitutions. C<s///> in list context
1449 returns the same thing as in scalar context, i.e., the number of
1452 B<The split operator>
1454 The B<C<split> > function can also optionally use a matching operator
1455 C<m//> to split a string. C<split /regexp/, string, limit> splits
1456 C<string> into a list of substrings and returns that list. The regexp
1457 is used to match the character sequence that the C<string> is split
1458 with respect to. The C<limit>, if present, constrains splitting into
1459 no more than C<limit> number of strings. For example, to split a
1460 string into words, use
1462 $x = "Calvin and Hobbes";
1463 @words = split /\s+/, $x; # $word[0] = 'Calvin'
1465 # $word[2] = 'Hobbes'
1467 If the empty regexp C<//> is used, the regexp always matches and
1468 the string is split into individual characters. If the regexp has
1469 groupings, then list produced contains the matched substrings from the
1470 groupings as well. For instance,
1472 $x = "/usr/bin/perl";
1473 @dirs = split m!/!, $x; # $dirs[0] = ''
1477 @parts = split m!(/)!, $x; # $parts[0] = ''
1483 # $parts[6] = 'perl'
1485 Since the first character of $x matched the regexp, C<split> prepended
1486 an empty initial element to the list.
1488 If you have read this far, congratulations! You now have all the basic
1489 tools needed to use regular expressions to solve a wide range of text
1490 processing problems. If this is your first time through the tutorial,
1491 why not stop here and play around with regexps a while... S<Part 2>
1492 concerns the more esoteric aspects of regular expressions and those
1493 concepts certainly aren't needed right at the start.
1495 =head1 Part 2: Power tools
1497 OK, you know the basics of regexps and you want to know more. If
1498 matching regular expressions is analogous to a walk in the woods, then
1499 the tools discussed in Part 1 are analogous to topo maps and a
1500 compass, basic tools we use all the time. Most of the tools in part 2
1501 are are analogous to flare guns and satellite phones. They aren't used
1502 too often on a hike, but when we are stuck, they can be invaluable.
1504 What follows are the more advanced, less used, or sometimes esoteric
1505 capabilities of perl regexps. In Part 2, we will assume you are
1506 comfortable with the basics and concentrate on the new features.
1508 =head2 More on characters, strings, and character classes
1510 There are a number of escape sequences and character classes that we
1511 haven't covered yet.
1513 There are several escape sequences that convert characters or strings
1514 between upper and lower case. C<\l> and C<\u> convert the next
1515 character to lower or upper case, respectively:
1518 $string =~ /\u$x/; # matches 'Perl' in $string
1519 $x = "M(rs?|s)\\."; # note the double backslash
1520 $string =~ /\l$x/; # matches 'mr.', 'mrs.', and 'ms.',
1522 C<\L> and C<\U> converts a whole substring, delimited by C<\L> or
1523 C<\U> and C<\E>, to lower or upper case:
1525 $x = "This word is in lower case:\L SHOUT\E";
1526 $x =~ /shout/; # matches
1527 $x = "I STILL KEYPUNCH CARDS FOR MY 360"
1528 $x =~ /\Ukeypunch/; # matches punch card string
1530 If there is no C<\E>, case is converted until the end of the
1531 string. The regexps C<\L\u$word> or C<\u\L$word> convert the first
1532 character of C<$word> to uppercase and the rest of the characters to
1535 Control characters can be escaped with C<\c>, so that a control-Z
1536 character would be matched with C<\cZ>. The escape sequence
1537 C<\Q>...C<\E> quotes, or protects most non-alphabetic characters. For
1540 $x = "\QThat !^*&%~& cat!";
1541 $x =~ /\Q!^*&%~&\E/; # check for rough language
1543 It does not protect C<$> or C<@>, so that variables can still be
1546 With the advent of 5.6.0, perl regexps can handle more than just the
1547 standard ASCII character set. Perl now supports B<Unicode>, a standard
1548 for encoding the character sets from many of the world's written
1549 languages. Unicode does this by allowing characters to be more than
1550 one byte wide. Perl uses the UTF-8 encoding, in which ASCII characters
1551 are still encoded as one byte, but characters greater than C<chr(127)>
1552 may be stored as two or more bytes.
1554 What does this mean for regexps? Well, regexp users don't need to know
1555 much about perl's internal representation of strings. But they do need
1556 to know 1) how to represent Unicode characters in a regexp and 2) when
1557 a matching operation will treat the string to be searched as a
1558 sequence of bytes (the old way) or as a sequence of Unicode characters
1559 (the new way). The answer to 1) is that Unicode characters greater
1560 than C<chr(127)> may be represented using the C<\x{hex}> notation,
1561 with C<hex> a hexadecimal integer:
1563 use utf8; # We will be doing Unicode processing
1564 /\x{263a}/; # match a Unicode smiley face :)
1566 Unicode characters in the range of 128-255 use two hexadecimal digits
1567 with braces: C<\x{ab}>. Note that this is different than C<\xab>,
1568 which is just a hexadecimal byte with no Unicode
1571 Figuring out the hexadecimal sequence of a Unicode character you want
1572 or deciphering someone else's hexadecimal Unicode regexp is about as
1573 much fun as programming in machine code. So another way to specify
1574 Unicode characters is to use the S<B<named character> > escape
1575 sequence C<\N{name}>. C<name> is a name for the Unicode character, as
1576 specified in the Unicode standard. For instance, if we wanted to
1577 represent or match the astrological sign for the planet Mercury, we
1580 use utf8; # We will be doing Unicode processing
1581 use charnames ":full"; # use named chars with Unicode full names
1582 $x = "abc\N{MERCURY}def";
1583 $x =~ /\N{MERCURY}/; # matches
1585 One can also use short names or restrict names to a certain alphabet:
1587 use utf8; # We will be doing Unicode processing
1589 use charnames ':full';
1590 print "\N{GREEK SMALL LETTER SIGMA} is called sigma.\n";
1592 use charnames ":short";
1593 print "\N{greek:Sigma} is an upper-case sigma.\n";
1595 use charnames qw(greek);
1596 print "\N{sigma} is Greek sigma\n";
1598 A list of full names is found in the file Names.txt in the
1599 lib/perl5/5.6.0/unicode directory.
1601 The answer to requirement 2), as of 5.6.0, is that if a regexp
1602 contains Unicode characters, the string is searched as a sequence of
1603 Unicode characters. Otherwise, the string is searched as a sequence of
1604 bytes. If the string is being searched as a sequence of Unicode
1605 characters, but matching a single byte is required, we can use the C<\C>
1606 escape sequence. C<\C> is a character class akin to C<.> except that
1607 it matches I<any> byte 0-255. So
1609 use utf8; # We will be doing Unicode processing
1610 use charnames ":full"; # use named chars with Unicode full names
1612 $x =~ /\C/; # matches 'a', eats one byte
1614 $x =~ /\C/; # doesn't match, no bytes to match
1615 $x = "\N{MERCURY}"; # two-byte Unicode character
1616 $x =~ /\C/; # matches, but dangerous!
1618 The last regexp matches, but is dangerous because the string
1619 I<character> position is no longer synchronized to the string I<byte>
1620 position. This generates the warning 'Malformed UTF-8
1621 character'. C<\C> is best used for matching the binary data in strings
1622 with binary data intermixed with Unicode characters.
1624 Let us now discuss the rest of the character classes. Just as with
1625 Unicode characters, there are named Unicode character classes
1626 represented by the C<\p{name}> escape sequence. Closely associated is
1627 the C<\P{name}> character class, which is the negation of the
1628 C<\p{name}> class. For example, to match lower and uppercase
1631 use utf8; # We will be doing Unicode processing
1632 use charnames ":full"; # use named chars with Unicode full names
1634 $x =~ /^\p{IsUpper}/; # matches, uppercase char class
1635 $x =~ /^\P{IsUpper}/; # doesn't match, char class sans uppercase
1636 $x =~ /^\p{IsLower}/; # doesn't match, lowercase char class
1637 $x =~ /^\P{IsLower}/; # matches, char class sans lowercase
1639 If a C<name> is just one letter, the braces can be dropped. For
1640 instance, C<\pM> is the character class of Unicode 'marks'. Here is
1641 the association between some Perl named classes and the traditional
1644 Perl class name Unicode class name
1646 IsAlpha Lu, Ll, or Lo
1647 IsAlnum Lu, Ll, Lo, or Nd
1648 IsASCII $code le 127
1651 IsGraph [^C] and $code ne "0020"
1655 IsSpace Z, or ($code lt "0020" and chr(hex $code) is a \s)
1657 IsWord Lu, Ll, Lo, Nd or $code eq "005F"
1658 IsXDigit $code =~ /^00(3[0-9]|[46][1-6])$/
1660 For a full list of Perl class names, consult the mktables.PL program
1661 in the lib/perl5/5.6.0/unicode directory.
1663 C<\X> is an abbreviation for a character class sequence that includes
1664 the Unicode 'combining character sequences'. A 'combining character
1665 sequence' is a base character followed by any number of combining
1666 characters. An example of a combining character is an accent. Using
1667 the Unicode full names, e.g., S<C<A + COMBINING RING> > is a combining
1668 character sequence with base character C<A> and combining character
1669 S<C<COMBINING RING> >, which translates in Danish to A with the circle
1670 atop it, as in the word Angstrom. C<\X> is equivalent to C<\PM\pM*}>,
1671 i.e., a non-mark followed by one or more marks.
1673 As if all those classes weren't enough, Perl also defines POSIX style
1674 character classes. These have the form C<[:name:]>, with C<name> the
1675 name of the POSIX class. The POSIX classes are C<alpha>, C<alnum>,
1676 C<ascii>, C<cntrl>, C<digit>, C<graph>, C<lower>, C<print>, C<punct>,
1677 C<space>, C<upper>, and C<xdigit>, and two extensions, C<word> (a Perl
1678 extension to match C<\w>), and C<blank> (a GNU extension). If C<utf8>
1679 is being used, then these classes are defined the same as their
1680 corresponding perl Unicode classes: C<[:upper:]> is the same as
1681 C<\p{IsUpper}>, etc. The POSIX character classes, however, don't
1682 require using C<utf8>. The C<[:digit:]>, C<[:word:]>, and
1683 C<[:space:]> correspond to the familiar C<\d>, C<\w>, and C<\s>
1684 character classes. To negate a POSIX class, put a C<^> in front of
1685 the name, so that, e.g., C<[:^digit:]> corresponds to C<\D> and under
1686 C<utf8>, C<\P{IsDigit}>. The Unicode and POSIX character classes can
1687 be used just like C<\d>, both inside and outside of character classes:
1689 /\s+[abc[:digit:]xyz]\s*/; # match a,b,c,x,y,z, or a digit
1690 /^=item\s[:digit:]/; # match '=item',
1691 # followed by a space and a digit
1693 use charnames ":full";
1694 /\s+[abc\p{IsDigit}xyz]\s+/; # match a,b,c,x,y,z, or a digit
1695 /^=item\s\p{IsDigit}/; # match '=item',
1696 # followed by a space and a digit
1698 Whew! That is all the rest of the characters and character classes.
1700 =head2 Compiling and saving regular expressions
1702 In Part 1 we discussed the C<//o> modifier, which compiles a regexp
1703 just once. This suggests that a compiled regexp is some data structure
1704 that can be stored once and used again and again. The regexp quote
1705 C<qr//> does exactly that: C<qr/string/> compiles the C<string> as a
1706 regexp and transforms the result into a form that can be assigned to a
1709 $reg = qr/foo+bar?/; # reg contains a compiled regexp
1711 Then C<$reg> can be used as a regexp:
1714 $x =~ $reg; # matches, just like /foo+bar?/
1715 $x =~ /$reg/; # same thing, alternate form
1717 C<$reg> can also be interpolated into a larger regexp:
1719 $x =~ /(abc)?$reg/; # still matches
1721 As with the matching operator, the regexp quote can use different
1722 delimiters, e.g., C<qr!!>, C<qr{}> and C<qr~~>. The single quote
1723 delimiters C<qr''> prevent any interpolation from taking place.
1725 Pre-compiled regexps are useful for creating dynamic matches that
1726 don't need to be recompiled each time they are encountered. Using
1727 pre-compiled regexps, C<simple_grep> program can be expanded into a
1728 program that matches multiple patterns:
1732 # multi_grep - match any of <number> regexps
1733 # usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ...
1736 $regexp[$_] = shift foreach (0..$number-1);
1737 @compiled = map qr/$_/, @regexp;
1738 while ($line = <>) {
1739 foreach $pattern (@compiled) {
1740 if ($line =~ /$pattern/) {
1742 last; # we matched, so move onto the next line
1748 % multi_grep 2 last for multi_grep
1749 $regexp[$_] = shift foreach (0..$number-1);
1750 foreach $pattern (@compiled) {
1753 Storing pre-compiled regexps in an array C<@compiled> allows us to
1754 simply loop through the regexps without any recompilation, thus gaining
1755 flexibility without sacrificing speed.
1757 =head2 Embedding comments and modifiers in a regular expression
1759 Starting with this section, we will be discussing Perl's set of
1760 B<extended patterns>. These are extensions to the traditional regular
1761 expression syntax that provide powerful new tools for pattern
1762 matching. We have already seen extensions in the form of the minimal
1763 matching constructs C<??>, C<*?>, C<+?>, C<{n,m}?>, and C<{n,}?>. The
1764 rest of the extensions below have the form C<(?char...)>, where the
1765 C<char> is a character that determines the type of extension.
1767 The first extension is an embedded comment C<(?#text)>. This embeds a
1768 comment into the regular expression without affecting its meaning. The
1769 comment should not have any closing parentheses in the text. An
1772 /(?# Match an integer:)[+-]?\d+/;
1774 This style of commenting has been largely superseded by the raw,
1775 freeform commenting that is allowed with the C<//x> modifier.
1777 The modifiers C<//i>, C<//m>, C<//s>, and C<//x> can also embedded in
1778 a regexp using C<(?i)>, C<(?m)>, C<(?s)>, and C<(?x)>. For instance,
1780 /(?i)yes/; # match 'yes' case insensitively
1781 /yes/i; # same thing
1782 /(?x)( # freeform version of an integer regexp
1783 [+-]? # match an optional sign
1784 \d+ # match a sequence of digits
1788 Embedded modifiers can have two important advantages over the usual
1789 modifiers. Embedded modifiers allow a custom set of modifiers to
1790 I<each> regexp pattern. This is great for matching an array of regexps
1791 that must have different modifiers:
1793 $pattern[0] = '(?i)doctor';
1794 $pattern[1] = 'Johnson';
1797 foreach $patt (@pattern) {
1802 The second advantage is that embedded modifiers only affect the regexp
1803 inside the group the embedded modifier is contained in. So grouping
1804 can be used to localize the modifier's effects:
1806 /Answer: ((?i)yes)/; # matches 'Answer: yes', 'Answer: YES', etc.
1808 Embedded modifiers can also turn off any modifiers already present
1809 by using, e.g., C<(?-i)>. Modifiers can also be combined into
1810 a single expression, e.g., C<(?s-i)> turns on single line mode and
1811 turns off case insensitivity.
1813 =head2 Non-capturing groupings
1815 We noted in Part 1 that groupings C<()> had two distinct functions: 1)
1816 group regexp elements together as a single unit, and 2) extract, or
1817 capture, substrings that matched the regexp in the
1818 grouping. Non-capturing groupings, denoted by C<(?:regexp)>, allow the
1819 regexp to be treated as a single unit, but don't extract substrings or
1820 set matching variables C<$1>, etc. Both capturing and non-capturing
1821 groupings are allowed to co-exist in the same regexp. Because there is
1822 no extraction, non-capturing groupings are faster than capturing
1823 groupings. Non-capturing groupings are also handy for choosing exactly
1824 which parts of a regexp are to be extracted to matching variables:
1826 # match a number, $1-$4 are set, but we only want $1
1827 /([+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?)/;
1829 # match a number faster , only $1 is set
1830 /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE][+-]?\d+)?)/;
1832 # match a number, get $1 = whole number, $2 = exponent
1833 /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE]([+-]?\d+))?)/;
1835 Non-capturing groupings are also useful for removing nuisance
1836 elements gathered from a split operation:
1839 @num = split /(a|b)/, $x; # @num = ('12','a','34','b','5')
1840 @num = split /(?:a|b)/, $x; # @num = ('12','34','5')
1842 Non-capturing groupings may also have embedded modifiers:
1843 C<(?i-m:regexp)> is a non-capturing grouping that matches C<regexp>
1844 case insensitively and turns off multi-line mode.
1846 =head2 Looking ahead and looking behind
1848 This section concerns the lookahead and lookbehind assertions. First,
1849 a little background.
1851 In Perl regular expressions, most regexp elements 'eat up' a certain
1852 amount of string when they match. For instance, the regexp element
1853 C<[abc}]> eats up one character of the string when it matches, in the
1854 sense that perl moves to the next character position in the string
1855 after the match. There are some elements, however, that don't eat up
1856 characters (advance the character position) if they match. The examples
1857 we have seen so far are the anchors. The anchor C<^> matches the
1858 beginning of the line, but doesn't eat any characters. Similarly, the
1859 word boundary anchor C<\b> matches, e.g., if the character to the left
1860 is a word character and the character to the right is a non-word
1861 character, but it doesn't eat up any characters itself. Anchors are
1862 examples of 'zero-width assertions'. Zero-width, because they consume
1863 no characters, and assertions, because they test some property of the
1864 string. In the context of our walk in the woods analogy to regexp
1865 matching, most regexp elements move us along a trail, but anchors have
1866 us stop a moment and check our surroundings. If the local environment
1867 checks out, we can proceed forward. But if the local environment
1868 doesn't satisfy us, we must backtrack.
1870 Checking the environment entails either looking ahead on the trail,
1871 looking behind, or both. C<^> looks behind, to see that there are no
1872 characters before. C<$> looks ahead, to see that there are no
1873 characters after. C<\b> looks both ahead and behind, to see if the
1874 characters on either side differ in their 'word'-ness.
1876 The lookahead and lookbehind assertions are generalizations of the
1877 anchor concept. Lookahead and lookbehind are zero-width assertions
1878 that let us specify which characters we want to test for. The
1879 lookahead assertion is denoted by C<(?=regexp)> and the lookbehind
1880 assertion is denoted by C<< (?<=fixed-regexp) >>. Some examples are
1882 $x = "I catch the housecat 'Tom-cat' with catnip";
1883 $x =~ /cat(?=\s+)/; # matches 'cat' in 'housecat'
1884 @catwords = ($x =~ /(?<=\s)cat\w+/g); # matches,
1885 # $catwords[0] = 'catch'
1886 # $catwords[1] = 'catnip'
1887 $x =~ /\bcat\b/; # matches 'cat' in 'Tom-cat'
1888 $x =~ /(?<=\s)cat(?=\s)/; # doesn't match; no isolated 'cat' in
1891 Note that the parentheses in C<(?=regexp)> and C<< (?<=regexp) >> are
1892 non-capturing, since these are zero-width assertions. Thus in the
1893 second regexp, the substrings captured are those of the whole regexp
1894 itself. Lookahead C<(?=regexp)> can match arbitrary regexps, but
1895 lookbehind C<< (?<=fixed-regexp) >> only works for regexps of fixed
1896 width, i.e., a fixed number of characters long. Thus
1897 C<< (?<=(ab|bc)) >> is fine, but C<< (?<=(ab)*) >> is not. The
1898 negated versions of the lookahead and lookbehind assertions are
1899 denoted by C<(?!regexp)> and C<< (?<!fixed-regexp) >> respectively.
1900 They evaluate true if the regexps do I<not> match:
1903 $x =~ /foo(?!bar)/; # doesn't match, 'bar' follows 'foo'
1904 $x =~ /foo(?!baz)/; # matches, 'baz' doesn't follow 'foo'
1905 $x =~ /(?<!\s)foo/; # matches, there is no \s before 'foo'
1907 =head2 Using independent subexpressions to prevent backtracking
1909 The last few extended patterns in this tutorial are experimental as of
1910 5.6.0. Play with them, use them in some code, but don't rely on them
1911 just yet for production code.
1913 S<B<Independent subexpressions> > are regular expressions, in the
1914 context of a larger regular expression, that function independently of
1915 the larger regular expression. That is, they consume as much or as
1916 little of the string as they wish without regard for the ability of
1917 the larger regexp to match. Independent subexpressions are represented
1918 by C<< (?>regexp) >>. We can illustrate their behavior by first
1919 considering an ordinary regexp:
1922 $x =~ /a*ab/; # matches
1924 This obviously matches, but in the process of matching, the
1925 subexpression C<a*> first grabbed the C<a>. Doing so, however,
1926 wouldn't allow the whole regexp to match, so after backtracking, C<a*>
1927 eventually gave back the C<a> and matched the empty string. Here, what
1928 C<a*> matched was I<dependent> on what the rest of the regexp matched.
1930 Contrast that with an independent subexpression:
1932 $x =~ /(?>a*)ab/; # doesn't match!
1934 The independent subexpression C<< (?>a*) >> doesn't care about the rest
1935 of the regexp, so it sees an C<a> and grabs it. Then the rest of the
1936 regexp C<ab> cannot match. Because C<< (?>a*) >> is independent, there
1937 is no backtracking and and the independent subexpression does not give
1938 up its C<a>. Thus the match of the regexp as a whole fails. A similar
1939 behavior occurs with completely independent regexps:
1942 $x =~ /a*/g; # matches, eats an 'a'
1943 $x =~ /\Gab/g; # doesn't match, no 'a' available
1945 Here C<//g> and C<\G> create a 'tag team' handoff of the string from
1946 one regexp to the other. Regexps with an independent subexpression are
1947 much like this, with a handoff of the string to the independent
1948 subexpression, and a handoff of the string back to the enclosing
1951 The ability of an independent subexpression to prevent backtracking
1952 can be quite useful. Suppose we want to match a non-empty string
1953 enclosed in parentheses up to two levels deep. Then the following
1956 $x = "abc(de(fg)h"; # unbalanced parentheses
1957 $x =~ /\( ( [^()]+ | \([^()]*\) )+ \)/x;
1959 The regexp matches an open parenthesis, one or more copies of an
1960 alternation, and a close parenthesis. The alternation is two-way, with
1961 the first alternative C<[^()]+> matching a substring with no
1962 parentheses and the second alternative C<\([^()]*\)> matching a
1963 substring delimited by parentheses. The problem with this regexp is
1964 that it is pathological: it has nested indeterminate quantifiers
1965 of the form C<(a+|b)+>. We discussed in Part 1 how nested quantifiers
1966 like this could take an exponentially long time to execute if there
1967 was no match possible. To prevent the exponential blowup, we need to
1968 prevent useless backtracking at some point. This can be done by
1969 enclosing the inner quantifier as an independent subexpression:
1971 $x =~ /\( ( (?>[^()]+) | \([^()]*\) )+ \)/x;
1973 Here, C<< (?>[^()]+) >> breaks the degeneracy of string partitioning
1974 by gobbling up as much of the string as possible and keeping it. Then
1975 match failures fail much more quickly.
1977 =head2 Conditional expressions
1979 A S<B<conditional expression> > is a form of if-then-else statement
1980 that allows one to choose which patterns are to be matched, based on
1981 some condition. There are two types of conditional expression:
1982 C<(?(condition)yes-regexp)> and
1983 C<(?(condition)yes-regexp|no-regexp)>. C<(?(condition)yes-regexp)> is
1984 like an S<C<'if () {}'> > statement in Perl. If the C<condition> is true,
1985 the C<yes-regexp> will be matched. If the C<condition> is false, the
1986 C<yes-regexp> will be skipped and perl will move onto the next regexp
1987 element. The second form is like an S<C<'if () {} else {}'> > statement
1988 in Perl. If the C<condition> is true, the C<yes-regexp> will be
1989 matched, otherwise the C<no-regexp> will be matched.
1991 The C<condition> can have two forms. The first form is simply an
1992 integer in parentheses C<(integer)>. It is true if the corresponding
1993 backreference C<\integer> matched earlier in the regexp. The second
1994 form is a bare zero width assertion C<(?...)>, either a
1995 lookahead, a lookbehind, or a code assertion (discussed in the next
1998 The integer form of the C<condition> allows us to choose, with more
1999 flexibility, what to match based on what matched earlier in the
2000 regexp. This searches for words of the form C<"$x$x"> or
2003 % simple_grep '^(\w+)(\w+)?(?(2)\2\1|\1)$' /usr/dict/words
2013 The lookbehind C<condition> allows, along with backreferences,
2014 an earlier part of the match to influence a later part of the
2015 match. For instance,
2017 /[ATGC]+(?(?<=AA)G|C)$/;
2019 matches a DNA sequence such that it either ends in C<AAG>, or some
2020 other base pair combination and C<C>. Note that the form is
2021 C<< (?(?<=AA)G|C) >> and not C<< (?((?<=AA))G|C) >>; for the
2022 lookahead, lookbehind or code assertions, the parentheses around the
2023 conditional are not needed.
2025 =head2 A bit of magic: executing Perl code in a regular expression
2027 Normally, regexps are a part of Perl expressions.
2028 S<B<Code evaluation> > expressions turn that around by allowing
2029 arbitrary Perl code to be a part of of a regexp. A code evaluation
2030 expression is denoted C<(?{code})>, with C<code> a string of Perl
2033 Code expressions are zero-width assertions, and the value they return
2034 depends on their environment. There are two possibilities: either the
2035 code expression is used as a conditional in a conditional expression
2036 C<(?(condition)...)>, or it is not. If the code expression is a
2037 conditional, the code is evaluated and the result (i.e., the result of
2038 the last statement) is used to determine truth or falsehood. If the
2039 code expression is not used as a conditional, the assertion always
2040 evaluates true and the result is put into the special variable
2041 C<$^R>. The variable C<$^R> can then be used in code expressions later
2042 in the regexp. Here are some silly examples:
2045 $x =~ /abc(?{print "Hi Mom!";})def/; # matches,
2047 $x =~ /aaa(?{print "Hi Mom!";})def/; # doesn't match,
2049 $x =~ /abc(?{print "Hi Mom!";})ddd/; # doesn't match,
2051 $x =~ /(?{print "Hi Mom!";})/; # matches,
2053 $x =~ /(?{$c = 1;})(?{print "$c";})/; # matches,
2055 $x =~ /(?{$c = 1;})(?{print "$^R";})/; # matches,
2058 The bit of magic mentioned in the section title occurs when the regexp
2059 backtracks in the process of searching for a match. If the regexp
2060 backtracks over a code expression and if the variables used within are
2061 localized using C<local>, the changes in the variables produced by the
2062 code expression are undone! Thus, if we wanted to count how many times
2063 a character got matched inside a group, we could use, e.g.,
2066 $count = 0; # initialize 'a' count
2067 $c = "bob"; # test if $c gets clobbered
2068 $x =~ /(?{local $c = 0;}) # initialize count
2070 (?{local $c = $c + 1;}) # increment count
2071 )* # do this any number of times,
2072 aa # but match 'aa' at the end
2073 (?{$count = $c;}) # copy local $c var into $count
2075 print "'a' count is $count, \$c variable is '$c'\n";
2079 'a' count is 2, $c variable is 'bob'
2081 If we replace the S<C< (?{local $c = $c + 1;})> > with
2082 S<C< (?{$c = $c + 1;})> >, the variable changes are I<not> undone
2083 during backtracking, and we get
2085 'a' count is 4, $c variable is 'bob'
2087 Note that only localized variable changes are undone. Other side
2088 effects of code expression execution are permanent. Thus
2091 $x =~ /(a(?{print "Yow\n";}))*aa/;
2100 The result C<$^R> is automatically localized, so that it will behave
2101 properly in the presence of backtracking.
2103 This example uses a code expression in a conditional to match the
2104 article 'the' in either English or German:
2106 $lang = 'DE'; # use German
2111 $lang eq 'EN'; # is the language English?
2113 the | # if so, then match 'the'
2114 (die|das|der) # else, match 'die|das|der'
2118 Note that the syntax here is C<(?(?{...})yes-regexp|no-regexp)>, not
2119 C<(?((?{...}))yes-regexp|no-regexp)>. In other words, in the case of a
2120 code expression, we don't need the extra parentheses around the
2123 If you try to use code expressions with interpolating variables, perl
2128 /foo(?{ $bar })bar/; # compiles ok, $bar not interpolated
2129 /foo(?{ 1 })$bar/; # compile error!
2130 /foo${pat}bar/; # compile error!
2132 $pat = qr/(?{ $foo = 1 })/; # precompile code regexp
2133 /foo${pat}bar/; # compiles ok
2135 If a regexp has (1) code expressions and interpolating variables,or
2136 (2) a variable that interpolates a code expression, perl treats the
2137 regexp as an error. If the code expression is precompiled into a
2138 variable, however, interpolating is ok. The question is, why is this
2141 The reason is that variable interpolation and code expressions
2142 together pose a security risk. The combination is dangerous because
2143 many programmers who write search engines often take user input and
2144 plug it directly into a regexp:
2146 $regexp = <>; # read user-supplied regexp
2147 $chomp $regexp; # get rid of possible newline
2148 $text =~ /$regexp/; # search $text for the $regexp
2150 If the C<$regexp> variable contains a code expression, the user could
2151 then execute arbitrary Perl code. For instance, some joker could
2152 search for S<C<system('rm -rf *');> > to erase your files. In this
2153 sense, the combination of interpolation and code expressions B<taints>
2154 your regexp. So by default, using both interpolation and code
2155 expressions in the same regexp is not allowed. If you're not
2156 concerned about malicious users, it is possible to bypass this
2157 security check by invoking S<C<use re 'eval'> >:
2159 use re 'eval'; # throw caution out the door
2162 /foo(?{ 1 })$bar/; # compiles ok
2163 /foo${pat}bar/; # compiles ok
2165 Another form of code expression is the S<B<pattern code expression> >.
2166 The pattern code expression is like a regular code expression, except
2167 that the result of the code evaluation is treated as a regular
2168 expression and matched immediately. A simple example is
2173 $x =~ /(??{$char x $length})/x; # matches, there are 5 of 'a'
2176 This final example contains both ordinary and pattern code
2177 expressions. It detects if a binary string C<1101010010001...> has a
2178 Fibonacci spacing 0,1,1,2,3,5,... of the C<1>'s:
2180 $s0 = 0; $s1 = 1; # initial conditions
2181 $x = "1101010010001000001";
2182 print "It is a Fibonacci sequence\n"
2183 if $x =~ /^1 # match an initial '1'
2185 (??{'0' x $s0}) # match $s0 of '0'
2188 $largest = $s0; # largest seq so far
2189 $s2 = $s1 + $s0; # compute next term
2190 $s0 = $s1; # in Fibonacci sequence
2193 )+ # repeat as needed
2194 $ # that is all there is
2196 print "Largest sequence matched was $largest\n";
2200 It is a Fibonacci sequence
2201 Largest sequence matched was 5
2203 Ha! Try that with your garden variety regexp package...
2205 Note that the variables C<$s0> and C<$s1> are not substituted when the
2206 regexp is compiled, as happens for ordinary variables outside a code
2207 expression. Rather, the code expressions are evaluated when perl
2208 encounters them during the search for a match.
2210 The regexp without the C<//x> modifier is
2212 /^1((??{'0'x$s0})1(?{$largest=$s0;$s2=$s1+$s0$s0=$s1;$s1=$s2;}))+$/;
2214 and is a great start on an Obfuscated Perl entry :-) When working with
2215 code and conditional expressions, the extended form of regexps is
2216 almost necessary in creating and debugging regexps.
2218 =head2 Pragmas and debugging
2220 Speaking of debugging, there are several pragmas available to control
2221 and debug regexps in Perl. We have already encountered one pragma in
2222 the previous section, S<C<use re 'eval';> >, that allows variable
2223 interpolation and code expressions to coexist in a regexp. The other
2228 @parts = ($tainted =~ /(\w+)\s+(\w+)/; # @parts is now tainted
2230 The C<taint> pragma causes any substrings from a match with a tainted
2231 variable to be tainted as well. This is not normally the case, as
2232 regexps are often used to extract the safe bits from a tainted
2233 variable. Use C<taint> when you are not extracting safe bits, but are
2234 performing some other processing. Both C<taint> and C<eval> pragmas
2235 are lexically scoped, which means they are in effect only until
2236 the end of the block enclosing the pragmas.
2239 /^(.*)$/s; # output debugging info
2241 use re 'debugcolor';
2242 /^(.*)$/s; # output debugging info in living color
2244 The global C<debug> and C<debugcolor> pragmas allow one to get
2245 detailed debugging info about regexp compilation and
2246 execution. C<debugcolor> is the same as debug, except the debugging
2247 information is displayed in color on terminals that can display
2248 termcap color sequences. Here is example output:
2250 % perl -e 'use re "debug"; "abc" =~ /a*b+c/;'
2251 Compiling REx `a*b+c'
2259 floating `bc' at 0..2147483647 (checking floating) minlen 2
2260 Guessing start of match, REx `a*b+c' against `abc'...
2261 Found floating substr `bc' at offset 1...
2262 Guessed: match at offset 0
2263 Matching REx `a*b+c' against `abc'
2264 Setting an EVAL scope, savestack=3
2265 0 <> <abc> | 1: STAR
2266 EXACT <a> can match 1 times out of 32767...
2267 Setting an EVAL scope, savestack=3
2268 1 <a> <bc> | 4: PLUS
2269 EXACT <b> can match 1 times out of 32767...
2270 Setting an EVAL scope, savestack=3
2271 2 <ab> <c> | 7: EXACT <c>
2274 Freeing REx: `a*b+c'
2276 If you have gotten this far into the tutorial, you can probably guess
2277 what the different parts of the debugging output tell you. The first
2280 Compiling REx `a*b+c'
2289 describes the compilation stage. C<STAR(4)> means that there is a
2290 starred object, in this case C<'a'>, and if it matches, goto line 4,
2291 i.e., C<PLUS(7)>. The middle lines describe some heuristics and
2292 optimizations performed before a match:
2294 floating `bc' at 0..2147483647 (checking floating) minlen 2
2295 Guessing start of match, REx `a*b+c' against `abc'...
2296 Found floating substr `bc' at offset 1...
2297 Guessed: match at offset 0
2299 Then the match is executed and the remaining lines describe the
2302 Matching REx `a*b+c' against `abc'
2303 Setting an EVAL scope, savestack=3
2304 0 <> <abc> | 1: STAR
2305 EXACT <a> can match 1 times out of 32767...
2306 Setting an EVAL scope, savestack=3
2307 1 <a> <bc> | 4: PLUS
2308 EXACT <b> can match 1 times out of 32767...
2309 Setting an EVAL scope, savestack=3
2310 2 <ab> <c> | 7: EXACT <c>
2313 Freeing REx: `a*b+c'
2315 Each step is of the form S<C<< n <x> <y> >> >, with C<< <x> >> the
2316 part of the string matched and C<< <y> >> the part not yet
2317 matched. The S<C<< | 1: STAR >> > says that perl is at line number 1
2318 n the compilation list above. See
2319 L<perldebguts/"Debugging regular expressions"> for much more detail.
2321 An alternative method of debugging regexps is to embed C<print>
2322 statements within the regexp. This provides a blow-by-blow account of
2323 the backtracking in an alternation:
2325 "that this" =~ m@(?{print "Start at position ", pos, "\n";})
2335 (?{print "Done at position ", pos, "\n";})
2351 Code expressions, conditional expressions, and independent expressions
2352 are B<experimental>. Don't use them in production code. Yet.
2356 This is just a tutorial. For the full story on perl regular
2357 expressions, see the L<perlre> regular expressions reference page.
2359 For more information on the matching C<m//> and substitution C<s///>
2360 operators, see L<perlop/"Regexp Quote-Like Operators">. For
2361 information on the C<split> operation, see L<perlfunc/split>.
2363 For an excellent all-around resource on the care and feeding of
2364 regular expressions, see the book I<Mastering Regular Expressions> by
2365 Jeffrey Friedl (published by O'Reilly, ISBN 1556592-257-3).
2367 =head1 AUTHOR AND COPYRIGHT
2369 Copyright (c) 2000 Mark Kvale
2370 All rights reserved.
2372 This document may be distributed under the same terms as Perl itself.
2374 =head2 Acknowledgments
2376 The inspiration for the stop codon DNA example came from the ZIP
2377 code example in chapter 7 of I<Mastering Regular Expressions>.
2379 The author would like to thank Jeff Pinyan, Andrew Johnson, Peter
2380 Haworth, Ronald J Kimball, and Joe Smith for all their helpful