Fix for ID 20010306.008, UTF-8 and \w without 'use utf8' coredump.
[p5sagit/p5-mst-13.2.git] / pod / perlretut.pod
CommitLineData
47f9c88b 1=head1 NAME
2
3perlretut - Perl regular expressions tutorial
4
5=head1 DESCRIPTION
6
7This page provides a basic tutorial on understanding, creating and
8using regular expressions in Perl. It serves as a complement to the
9reference page on regular expressions L<perlre>. Regular expressions
10are an integral part of the C<m//>, C<s///>, C<qr//> and C<split>
11operators and so this tutorial also overlaps with
12L<perlop/"Regexp Quote-Like Operators"> and L<perlfunc/split>.
13
14Perl is widely renowned for excellence in text processing, and regular
15expressions are one of the big factors behind this fame. Perl regular
16expressions display an efficiency and flexibility unknown in most
17other computer languages. Mastering even the basics of regular
18expressions will allow you to manipulate text with surprising ease.
19
20What is a regular expression? A regular expression is simply a string
21that describes a pattern. Patterns are in common use these days;
22examples are the patterns typed into a search engine to find web pages
23and the patterns used to list files in a directory, e.g., C<ls *.txt>
24or C<dir *.*>. In Perl, the patterns described by regular expressions
25are used to search strings, extract desired parts of strings, and to
26do search and replace operations.
27
28Regular expressions have the undeserved reputation of being abstract
29and difficult to understand. Regular expressions are constructed using
30simple concepts like conditionals and loops and are no more difficult
31to understand than the corresponding C<if> conditionals and C<while>
32loops in the Perl language itself. In fact, the main challenge in
33learning regular expressions is just getting used to the terse
34notation used to express these concepts.
35
36This tutorial flattens the learning curve by discussing regular
37expression concepts, along with their notation, one at a time and with
38many examples. The first part of the tutorial will progress from the
39simplest word searches to the basic regular expression concepts. If
40you master the first part, you will have all the tools needed to solve
41about 98% of your needs. The second part of the tutorial is for those
42comfortable with the basics and hungry for more power tools. It
43discusses the more advanced regular expression operators and
44introduces the latest cutting edge innovations in 5.6.0.
45
46A note: to save time, 'regular expression' is often abbreviated as
47regexp or regex. Regexp is a more natural abbreviation than regex, but
48is harder to pronounce. The Perl pod documentation is evenly split on
49regexp vs regex; in Perl, there is more than one way to abbreviate it.
50We'll use regexp in this tutorial.
51
52=head1 Part 1: The basics
53
54=head2 Simple word matching
55
56The simplest regexp is simply a word, or more generally, a string of
57characters. A regexp consisting of a word matches any string that
58contains that word:
59
60 "Hello World" =~ /World/; # matches
61
62What is this perl statement all about? C<"Hello World"> is a simple
63double quoted string. C<World> is the regular expression and the
64C<//> enclosing C</World/> tells perl to search a string for a match.
65The operator C<=~> associates the string with the regexp match and
66produces a true value if the regexp matched, or false if the regexp
67did not match. In our case, C<World> matches the second word in
68C<"Hello World">, so the expression is true. Expressions like this
69are useful in conditionals:
70
71 if ("Hello World" =~ /World/) {
72 print "It matches\n";
73 }
74 else {
75 print "It doesn't match\n";
76 }
77
78There are useful variations on this theme. The sense of the match can
79be reversed by using C<!~> operator:
80
81 if ("Hello World" !~ /World/) {
82 print "It doesn't match\n";
83 }
84 else {
85 print "It matches\n";
86 }
87
88The literal string in the regexp can be replaced by a variable:
89
90 $greeting = "World";
91 if ("Hello World" =~ /$greeting/) {
92 print "It matches\n";
93 }
94 else {
95 print "It doesn't match\n";
96 }
97
98If you're matching against the special default variable C<$_>, the
99C<$_ =~> part can be omitted:
100
101 $_ = "Hello World";
102 if (/World/) {
103 print "It matches\n";
104 }
105 else {
106 print "It doesn't match\n";
107 }
108
109And finally, the C<//> default delimiters for a match can be changed
110to arbitrary delimiters by putting an C<'m'> out front:
111
112 "Hello World" =~ m!World!; # matches, delimited by '!'
113 "Hello World" =~ m{World}; # matches, note the matching '{}'
a6b2f353 114 "/usr/bin/perl" =~ m"/perl"; # matches after '/usr/bin',
115 # '/' becomes an ordinary char
47f9c88b 116
117C</World/>, C<m!World!>, and C<m{World}> all represent the
118same thing. When, e.g., C<""> is used as a delimiter, the forward
119slash C<'/'> becomes an ordinary character and can be used in a regexp
120without trouble.
121
122Let's consider how different regexps would match C<"Hello World">:
123
124 "Hello World" =~ /world/; # doesn't match
125 "Hello World" =~ /o W/; # matches
126 "Hello World" =~ /oW/; # doesn't match
127 "Hello World" =~ /World /; # doesn't match
128
129The first regexp C<world> doesn't match because regexps are
130case-sensitive. The second regexp matches because the substring
131S<C<'o W'> > occurs in the string S<C<"Hello World"> >. The space
132character ' ' is treated like any other character in a regexp and is
133needed to match in this case. The lack of a space character is the
134reason the third regexp C<'oW'> doesn't match. The fourth regexp
135C<'World '> doesn't match because there is a space at the end of the
136regexp, but not at the end of the string. The lesson here is that
137regexps must match a part of the string I<exactly> in order for the
138statement to be true.
139
140If a regexp matches in more than one place in the string, perl will
141always match at the earliest possible point in the string:
142
143 "Hello World" =~ /o/; # matches 'o' in 'Hello'
144 "That hat is red" =~ /hat/; # matches 'hat' in 'That'
145
146With respect to character matching, there are a few more points you
147need to know about. First of all, not all characters can be used 'as
148is' in a match. Some characters, called B<metacharacters>, are reserved
149for use in regexp notation. The metacharacters are
150
151 {}[]()^$.|*+?\
152
153The significance of each of these will be explained
154in the rest of the tutorial, but for now, it is important only to know
155that a metacharacter can be matched by putting a backslash before it:
156
157 "2+2=4" =~ /2+2/; # doesn't match, + is a metacharacter
158 "2+2=4" =~ /2\+2/; # matches, \+ is treated like an ordinary +
159 "The interval is [0,1)." =~ /[0,1)./ # is a syntax error!
160 "The interval is [0,1)." =~ /\[0,1\)\./ # matches
161 "/usr/bin/perl" =~ /\/usr\/local\/bin\/perl/; # matches
162
163In the last regexp, the forward slash C<'/'> is also backslashed,
164because it is used to delimit the regexp. This can lead to LTS
165(leaning toothpick syndrome), however, and it is often more readable
166to change delimiters.
167
168
169The backslash character C<'\'> is a metacharacter itself and needs to
170be backslashed:
171
172 'C:\WIN32' =~ /C:\\WIN/; # matches
173
174In addition to the metacharacters, there are some ASCII characters
175which don't have printable character equivalents and are instead
176represented by B<escape sequences>. Common examples are C<\t> for a
177tab, C<\n> for a newline, C<\r> for a carriage return and C<\a> for a
178bell. If your string is better thought of as a sequence of arbitrary
179bytes, the octal escape sequence, e.g., C<\033>, or hexadecimal escape
180sequence, e.g., C<\x1B> may be a more natural representation for your
181bytes. Here are some examples of escapes:
182
183 "1000\t2000" =~ m(0\t2) # matches
184 "1000\n2000" =~ /0\n20/ # matches
185 "1000\t2000" =~ /\000\t2/ # doesn't match, "0" ne "\000"
186 "cat" =~ /\143\x61\x74/ # matches, but a weird way to spell cat
187
188If you've been around Perl a while, all this talk of escape sequences
189may seem familiar. Similar escape sequences are used in double-quoted
190strings and in fact the regexps in Perl are mostly treated as
191double-quoted strings. This means that variables can be used in
192regexps as well. Just like double-quoted strings, the values of the
193variables in the regexp will be substituted in before the regexp is
194evaluated for matching purposes. So we have:
195
196 $foo = 'house';
197 'housecat' =~ /$foo/; # matches
198 'cathouse' =~ /cat$foo/; # matches
47f9c88b 199 'housecat' =~ /${foo}cat/; # matches
200
201So far, so good. With the knowledge above you can already perform
202searches with just about any literal string regexp you can dream up.
203Here is a I<very simple> emulation of the Unix grep program:
204
205 % cat > simple_grep
206 #!/usr/bin/perl
207 $regexp = shift;
208 while (<>) {
209 print if /$regexp/;
210 }
211 ^D
212
213 % chmod +x simple_grep
214
215 % simple_grep abba /usr/dict/words
216 Babbage
217 cabbage
218 cabbages
219 sabbath
220 Sabbathize
221 Sabbathizes
222 sabbatical
223 scabbard
224 scabbards
225
226This program is easy to understand. C<#!/usr/bin/perl> is the standard
227way to invoke a perl program from the shell.
228S<C<$regexp = shift;> > saves the first command line argument as the
229regexp to be used, leaving the rest of the command line arguments to
230be treated as files. S<C<< while (<>) >> > loops over all the lines in
231all the files. For each line, S<C<print if /$regexp/;> > prints the
232line if the regexp matches the line. In this line, both C<print> and
233C</$regexp/> use the default variable C<$_> implicitly.
234
235With all of the regexps above, if the regexp matched anywhere in the
236string, it was considered a match. Sometimes, however, we'd like to
237specify I<where> in the string the regexp should try to match. To do
238this, we would use the B<anchor> metacharacters C<^> and C<$>. The
239anchor C<^> means match at the beginning of the string and the anchor
240C<$> means match at the end of the string, or before a newline at the
241end of the string. Here is how they are used:
242
243 "housekeeper" =~ /keeper/; # matches
244 "housekeeper" =~ /^keeper/; # doesn't match
245 "housekeeper" =~ /keeper$/; # matches
246 "housekeeper\n" =~ /keeper$/; # matches
247
248The second regexp doesn't match because C<^> constrains C<keeper> to
249match only at the beginning of the string, but C<"housekeeper"> has
250keeper starting in the middle. The third regexp does match, since the
251C<$> constrains C<keeper> to match only at the end of the string.
252
253When both C<^> and C<$> are used at the same time, the regexp has to
254match both the beginning and the end of the string, i.e., the regexp
255matches the whole string. Consider
256
257 "keeper" =~ /^keep$/; # doesn't match
258 "keeper" =~ /^keeper$/; # matches
259 "" =~ /^$/; # ^$ matches an empty string
260
261The first regexp doesn't match because the string has more to it than
262C<keep>. Since the second regexp is exactly the string, it
263matches. Using both C<^> and C<$> in a regexp forces the complete
264string to match, so it gives you complete control over which strings
265match and which don't. Suppose you are looking for a fellow named
266bert, off in a string by himself:
267
268 "dogbert" =~ /bert/; # matches, but not what you want
269
270 "dilbert" =~ /^bert/; # doesn't match, but ..
271 "bertram" =~ /^bert/; # matches, so still not good enough
272
273 "bertram" =~ /^bert$/; # doesn't match, good
274 "dilbert" =~ /^bert$/; # doesn't match, good
275 "bert" =~ /^bert$/; # matches, perfect
276
277Of course, in the case of a literal string, one could just as easily
278use the string equivalence S<C<$string eq 'bert'> > and it would be
279more efficient. The C<^...$> regexp really becomes useful when we
280add in the more powerful regexp tools below.
281
282=head2 Using character classes
283
284Although one can already do quite a lot with the literal string
285regexps above, we've only scratched the surface of regular expression
286technology. In this and subsequent sections we will introduce regexp
287concepts (and associated metacharacter notations) that will allow a
288regexp to not just represent a single character sequence, but a I<whole
289class> of them.
290
291One such concept is that of a B<character class>. A character class
292allows a set of possible characters, rather than just a single
293character, to match at a particular point in a regexp. Character
294classes are denoted by brackets C<[...]>, with the set of characters
295to be possibly matched inside. Here are some examples:
296
297 /cat/; # matches 'cat'
298 /[bcr]at/; # matches 'bat, 'cat', or 'rat'
299 /item[0123456789]/; # matches 'item0' or ... or 'item9'
a6b2f353 300 "abc" =~ /[cab]/; # matches 'a'
47f9c88b 301
302In the last statement, even though C<'c'> is the first character in
303the class, C<'a'> matches because the first character position in the
304string is the earliest point at which the regexp can match.
305
306 /[yY][eE][sS]/; # match 'yes' in a case-insensitive way
307 # 'yes', 'Yes', 'YES', etc.
308
309This regexp displays a common task: perform a a case-insensitive
310match. Perl provides away of avoiding all those brackets by simply
311appending an C<'i'> to the end of the match. Then C</[yY][eE][sS]/;>
312can be rewritten as C</yes/i;>. The C<'i'> stands for
313case-insensitive and is an example of a B<modifier> of the matching
314operation. We will meet other modifiers later in the tutorial.
315
316We saw in the section above that there were ordinary characters, which
317represented themselves, and special characters, which needed a
318backslash C<\> to represent themselves. The same is true in a
319character class, but the sets of ordinary and special characters
320inside a character class are different than those outside a character
321class. The special characters for a character class are C<-]\^$>. C<]>
322is special because it denotes the end of a character class. C<$> is
323special because it denotes a scalar variable. C<\> is special because
324it is used in escape sequences, just like above. Here is how the
325special characters C<]$\> are handled:
326
327 /[\]c]def/; # matches ']def' or 'cdef'
328 $x = 'bcr';
a6b2f353 329 /[$x]at/; # matches 'bat', 'cat', or 'rat'
47f9c88b 330 /[\$x]at/; # matches '$at' or 'xat'
331 /[\\$x]at/; # matches '\at', 'bat, 'cat', or 'rat'
332
333The last two are a little tricky. in C<[\$x]>, the backslash protects
334the dollar sign, so the character class has two members C<$> and C<x>.
335In C<[\\$x]>, the backslash is protected, so C<$x> is treated as a
336variable and substituted in double quote fashion.
337
338The special character C<'-'> acts as a range operator within character
339classes, so that a contiguous set of characters can be written as a
340range. With ranges, the unwieldy C<[0123456789]> and C<[abc...xyz]>
341become the svelte C<[0-9]> and C<[a-z]>. Some examples are
342
343 /item[0-9]/; # matches 'item0' or ... or 'item9'
344 /[0-9bx-z]aa/; # matches '0aa', ..., '9aa',
345 # 'baa', 'xaa', 'yaa', or 'zaa'
346 /[0-9a-fA-F]/; # matches a hexadecimal digit
36bbe248 347 /[0-9a-zA-Z_]/; # matches a "word" character,
47f9c88b 348 # like those in a perl variable name
349
350If C<'-'> is the first or last character in a character class, it is
351treated as an ordinary character; C<[-ab]>, C<[ab-]> and C<[a\-b]> are
352all equivalent.
353
354The special character C<^> in the first position of a character class
355denotes a B<negated character class>, which matches any character but
a6b2f353 356those in the brackets. Both C<[...]> and C<[^...]> must match a
47f9c88b 357character, or the match fails. Then
358
359 /[^a]at/; # doesn't match 'aat' or 'at', but matches
360 # all other 'bat', 'cat, '0at', '%at', etc.
361 /[^0-9]/; # matches a non-numeric character
362 /[a^]at/; # matches 'aat' or '^at'; here '^' is ordinary
363
364Now, even C<[0-9]> can be a bother the write multiple times, so in the
365interest of saving keystrokes and making regexps more readable, Perl
366has several abbreviations for common character classes:
367
368=over 4
369
370=item *
551e1d92 371
47f9c88b 372\d is a digit and represents [0-9]
373
374=item *
551e1d92 375
47f9c88b 376\s is a whitespace character and represents [\ \t\r\n\f]
377
378=item *
551e1d92 379
47f9c88b 380\w is a word character (alphanumeric or _) and represents [0-9a-zA-Z_]
381
382=item *
551e1d92 383
47f9c88b 384\D is a negated \d; it represents any character but a digit [^0-9]
385
386=item *
551e1d92 387
47f9c88b 388\S is a negated \s; it represents any non-whitespace character [^\s]
389
390=item *
551e1d92 391
47f9c88b 392\W is a negated \w; it represents any non-word character [^\w]
393
394=item *
551e1d92 395
47f9c88b 396The period '.' matches any character but "\n"
397
398=back
399
400The C<\d\s\w\D\S\W> abbreviations can be used both inside and outside
401of character classes. Here are some in use:
402
403 /\d\d:\d\d:\d\d/; # matches a hh:mm:ss time format
404 /[\d\s]/; # matches any digit or whitespace character
405 /\w\W\w/; # matches a word char, followed by a
406 # non-word char, followed by a word char
407 /..rt/; # matches any two chars, followed by 'rt'
408 /end\./; # matches 'end.'
409 /end[.]/; # same thing, matches 'end.'
410
411Because a period is a metacharacter, it needs to be escaped to match
412as an ordinary period. Because, for example, C<\d> and C<\w> are sets
413of characters, it is incorrect to think of C<[^\d\w]> as C<[\D\W]>; in
414fact C<[^\d\w]> is the same as C<[^\w]>, which is the same as
415C<[\W]>. Think DeMorgan's laws.
416
417An anchor useful in basic regexps is the S<B<word anchor> >
418C<\b>. This matches a boundary between a word character and a non-word
419character C<\w\W> or C<\W\w>:
420
421 $x = "Housecat catenates house and cat";
422 $x =~ /cat/; # matches cat in 'housecat'
423 $x =~ /\bcat/; # matches cat in 'catenates'
424 $x =~ /cat\b/; # matches cat in 'housecat'
425 $x =~ /\bcat\b/; # matches 'cat' at end of string
426
427Note in the last example, the end of the string is considered a word
428boundary.
429
430You might wonder why C<'.'> matches everything but C<"\n"> - why not
431every character? The reason is that often one is matching against
432lines and would like to ignore the newline characters. For instance,
433while the string C<"\n"> represents one line, we would like to think
434of as empty. Then
435
436 "" =~ /^$/; # matches
437 "\n" =~ /^$/; # matches, "\n" is ignored
438
439 "" =~ /./; # doesn't match; it needs a char
440 "" =~ /^.$/; # doesn't match; it needs a char
441 "\n" =~ /^.$/; # doesn't match; it needs a char other than "\n"
442 "a" =~ /^.$/; # matches
443 "a\n" =~ /^.$/; # matches, ignores the "\n"
444
445This behavior is convenient, because we usually want to ignore
446newlines when we count and match characters in a line. Sometimes,
447however, we want to keep track of newlines. We might even want C<^>
448and C<$> to anchor at the beginning and end of lines within the
449string, rather than just the beginning and end of the string. Perl
450allows us to choose between ignoring and paying attention to newlines
451by using the C<//s> and C<//m> modifiers. C<//s> and C<//m> stand for
452single line and multi-line and they determine whether a string is to
453be treated as one continuous string, or as a set of lines. The two
454modifiers affect two aspects of how the regexp is interpreted: 1) how
455the C<'.'> character class is defined, and 2) where the anchors C<^>
456and C<$> are able to match. Here are the four possible combinations:
457
458=over 4
459
460=item *
551e1d92 461
47f9c88b 462no modifiers (//): Default behavior. C<'.'> matches any character
463except C<"\n">. C<^> matches only at the beginning of the string and
464C<$> matches only at the end or before a newline at the end.
465
466=item *
551e1d92 467
47f9c88b 468s modifier (//s): Treat string as a single long line. C<'.'> matches
469any character, even C<"\n">. C<^> matches only at the beginning of
470the string and C<$> matches only at the end or before a newline at the
471end.
472
473=item *
551e1d92 474
47f9c88b 475m modifier (//m): Treat string as a set of multiple lines. C<'.'>
476matches any character except C<"\n">. C<^> and C<$> are able to match
477at the start or end of I<any> line within the string.
478
479=item *
551e1d92 480
47f9c88b 481both s and m modifiers (//sm): Treat string as a single long line, but
482detect multiple lines. C<'.'> matches any character, even
483C<"\n">. C<^> and C<$>, however, are able to match at the start or end
484of I<any> line within the string.
485
486=back
487
488Here are examples of C<//s> and C<//m> in action:
489
490 $x = "There once was a girl\nWho programmed in Perl\n";
491
492 $x =~ /^Who/; # doesn't match, "Who" not at start of string
493 $x =~ /^Who/s; # doesn't match, "Who" not at start of string
494 $x =~ /^Who/m; # matches, "Who" at start of second line
495 $x =~ /^Who/sm; # matches, "Who" at start of second line
496
497 $x =~ /girl.Who/; # doesn't match, "." doesn't match "\n"
498 $x =~ /girl.Who/s; # matches, "." matches "\n"
499 $x =~ /girl.Who/m; # doesn't match, "." doesn't match "\n"
500 $x =~ /girl.Who/sm; # matches, "." matches "\n"
501
502Most of the time, the default behavior is what is want, but C<//s> and
503C<//m> are occasionally very useful. If C<//m> is being used, the start
504of the string can still be matched with C<\A> and the end of string
505can still be matched with the anchors C<\Z> (matches both the end and
506the newline before, like C<$>), and C<\z> (matches only the end):
507
508 $x =~ /^Who/m; # matches, "Who" at start of second line
509 $x =~ /\AWho/m; # doesn't match, "Who" is not at start of string
510
511 $x =~ /girl$/m; # matches, "girl" at end of first line
512 $x =~ /girl\Z/m; # doesn't match, "girl" is not at end of string
513
514 $x =~ /Perl\Z/m; # matches, "Perl" is at newline before end
515 $x =~ /Perl\z/m; # doesn't match, "Perl" is not at end of string
516
517We now know how to create choices among classes of characters in a
518regexp. What about choices among words or character strings? Such
519choices are described in the next section.
520
521=head2 Matching this or that
522
523Sometimes we would like to our regexp to be able to match different
524possible words or character strings. This is accomplished by using
525the B<alternation> metacharacter C<|>. To match C<dog> or C<cat>, we
526form the regexp C<dog|cat>. As before, perl will try to match the
527regexp at the earliest possible point in the string. At each
528character position, perl will first try to match the first
529alternative, C<dog>. If C<dog> doesn't match, perl will then try the
530next alternative, C<cat>. If C<cat> doesn't match either, then the
531match fails and perl moves to the next position in the string. Some
532examples:
533
534 "cats and dogs" =~ /cat|dog|bird/; # matches "cat"
535 "cats and dogs" =~ /dog|cat|bird/; # matches "cat"
536
537Even though C<dog> is the first alternative in the second regexp,
538C<cat> is able to match earlier in the string.
539
540 "cats" =~ /c|ca|cat|cats/; # matches "c"
541 "cats" =~ /cats|cat|ca|c/; # matches "cats"
542
543Here, all the alternatives match at the first string position, so the
544first alternative is the one that matches. If some of the
545alternatives are truncations of the others, put the longest ones first
546to give them a chance to match.
547
548 "cab" =~ /a|b|c/ # matches "c"
549 # /a|b|c/ == /[abc]/
550
551The last example points out that character classes are like
552alternations of characters. At a given character position, the first
553alternative that allows the regexp match to succeed wil be the one
554that matches.
555
556=head2 Grouping things and hierarchical matching
557
558Alternation allows a regexp to choose among alternatives, but by
559itself it unsatisfying. The reason is that each alternative is a whole
560regexp, but sometime we want alternatives for just part of a
561regexp. For instance, suppose we want to search for housecats or
562housekeepers. The regexp C<housecat|housekeeper> fits the bill, but is
563inefficient because we had to type C<house> twice. It would be nice to
564have parts of the regexp be constant, like C<house>, and and some
565parts have alternatives, like C<cat|keeper>.
566
567The B<grouping> metacharacters C<()> solve this problem. Grouping
568allows parts of a regexp to be treated as a single unit. Parts of a
569regexp are grouped by enclosing them in parentheses. Thus we could solve
570the C<housecat|housekeeper> by forming the regexp as
571C<house(cat|keeper)>. The regexp C<house(cat|keeper)> means match
572C<house> followed by either C<cat> or C<keeper>. Some more examples
573are
574
575 /(a|b)b/; # matches 'ab' or 'bb'
576 /(ac|b)b/; # matches 'acb' or 'bb'
577 /(^a|b)c/; # matches 'ac' at start of string or 'bc' anywhere
578 /(a|[bc])d/; # matches 'ad', 'bd', or 'cd'
579
580 /house(cat|)/; # matches either 'housecat' or 'house'
581 /house(cat(s|)|)/; # matches either 'housecats' or 'housecat' or
582 # 'house'. Note groups can be nested.
583
584 /(19|20|)\d\d/; # match years 19xx, 20xx, or the Y2K problem, xx
585 "20" =~ /(19|20|)\d\d/; # matches the null alternative '()\d\d',
586 # because '20\d\d' can't match
587
588Alternations behave the same way in groups as out of them: at a given
589string position, the leftmost alternative that allows the regexp to
590match is taken. So in the last example at tth first string position,
591C<"20"> matches the second alternative, but there is nothing left over
592to match the next two digits C<\d\d>. So perl moves on to the next
593alternative, which is the null alternative and that works, since
594C<"20"> is two digits.
595
596The process of trying one alternative, seeing if it matches, and
597moving on to the next alternative if it doesn't, is called
598B<backtracking>. The term 'backtracking' comes from the idea that
599matching a regexp is like a walk in the woods. Successfully matching
600a regexp is like arriving at a destination. There are many possible
601trailheads, one for each string position, and each one is tried in
602order, left to right. From each trailhead there may be many paths,
603some of which get you there, and some which are dead ends. When you
604walk along a trail and hit a dead end, you have to backtrack along the
605trail to an earlier point to try another trail. If you hit your
606destination, you stop immediately and forget about trying all the
607other trails. You are persistent, and only if you have tried all the
608trails from all the trailheads and not arrived at your destination, do
609you declare failure. To be concrete, here is a step-by-step analysis
610of what perl does when it tries to match the regexp
611
612 "abcde" =~ /(abd|abc)(df|d|de)/;
613
614=over 4
615
551e1d92 616=item 0
617
618Start with the first letter in the string 'a'.
619
620=item 1
47f9c88b 621
551e1d92 622Try the first alternative in the first group 'abd'.
47f9c88b 623
551e1d92 624=item 2
47f9c88b 625
551e1d92 626Match 'a' followed by 'b'. So far so good.
627
628=item 3
629
630'd' in the regexp doesn't match 'c' in the string - a dead
47f9c88b 631end. So backtrack two characters and pick the second alternative in
632the first group 'abc'.
633
551e1d92 634=item 4
635
636Match 'a' followed by 'b' followed by 'c'. We are on a roll
47f9c88b 637and have satisfied the first group. Set $1 to 'abc'.
638
551e1d92 639=item 5
640
641Move on to the second group and pick the first alternative
47f9c88b 642'df'.
643
551e1d92 644=item 6
47f9c88b 645
551e1d92 646Match the 'd'.
647
648=item 7
649
650'f' in the regexp doesn't match 'e' in the string, so a dead
47f9c88b 651end. Backtrack one character and pick the second alternative in the
652second group 'd'.
653
551e1d92 654=item 8
655
656'd' matches. The second grouping is satisfied, so set $2 to
47f9c88b 657'd'.
658
551e1d92 659=item 9
660
661We are at the end of the regexp, so we are done! We have
47f9c88b 662matched 'abcd' out of the string "abcde".
663
664=back
665
666There are a couple of things to note about this analysis. First, the
667third alternative in the second group 'de' also allows a match, but we
668stopped before we got to it - at a given character position, leftmost
669wins. Second, we were able to get a match at the first character
670position of the string 'a'. If there were no matches at the first
671position, perl would move to the second character position 'b' and
672attempt the match all over again. Only when all possible paths at all
673possible character positions have been exhausted does perl give give
674up and declare S<C<$string =~ /(abd|abc)(df|d|de)/;> > to be false.
675
676Even with all this work, regexp matching happens remarkably fast. To
677speed things up, during compilation stage, perl compiles the regexp
678into a compact sequence of opcodes that can often fit inside a
679processor cache. When the code is executed, these opcodes can then run
680at full throttle and search very quickly.
681
682=head2 Extracting matches
683
684The grouping metacharacters C<()> also serve another completely
685different function: they allow the extraction of the parts of a string
686that matched. This is very useful to find out what matched and for
687text processing in general. For each grouping, the part that matched
688inside goes into the special variables C<$1>, C<$2>, etc. They can be
689used just as ordinary variables:
690
691 # extract hours, minutes, seconds
692 $time =~ /(\d\d):(\d\d):(\d\d)/; # match hh:mm:ss format
693 $hours = $1;
694 $minutes = $2;
695 $seconds = $3;
696
697Now, we know that in scalar context,
698S<C<$time =~ /(\d\d):(\d\d):(\d\d)/> > returns a true or false
699value. In list context, however, it returns the list of matched values
700C<($1,$2,$3)>. So we could write the code more compactly as
701
702 # extract hours, minutes, seconds
703 ($hours, $minutes, $second) = ($time =~ /(\d\d):(\d\d):(\d\d)/);
704
705If the groupings in a regexp are nested, C<$1> gets the group with the
706leftmost opening parenthesis, C<$2> the next opening parenthesis,
707etc. For example, here is a complex regexp and the matching variables
708indicated below it:
709
710 /(ab(cd|ef)((gi)|j))/;
711 1 2 34
712
713so that if the regexp matched, e.g., C<$2> would contain 'cd' or 'ef'.
714For convenience, perl sets C<$+> to the highest numbered C<$1>, C<$2>,
715... that got assigned.
716
717Closely associated with the matching variables C<$1>, C<$2>, ... are
718the B<backreferences> C<\1>, C<\2>, ... . Backreferences are simply
719matching variables that can be used I<inside> a regexp. This is a
720really nice feature - what matches later in a regexp can depend on
721what matched earlier in the regexp. Suppose we wanted to look
722for doubled words in text, like 'the the'. The following regexp finds
723all 3-letter doubles with a space in between:
724
725 /(\w\w\w)\s\1/;
726
727The grouping assigns a value to \1, so that the same 3 letter sequence
728is used for both parts. Here are some words with repeated parts:
729
730 % simple_grep '^(\w\w\w\w|\w\w\w|\w\w|\w)\1$' /usr/dict/words
731 beriberi
732 booboo
733 coco
734 mama
735 murmur
736 papa
737
738The regexp has a single grouping which considers 4-letter
739combinations, then 3-letter combinations, etc. and uses C<\1> to look for
740a repeat. Although C<$1> and C<\1> represent the same thing, care should be
741taken to use matched variables C<$1>, C<$2>, ... only outside a regexp
742and backreferences C<\1>, C<\2>, ... only inside a regexp; not doing
743so may lead to surprising and/or undefined results.
744
745In addition to what was matched, Perl 5.6.0 also provides the
746positions of what was matched with the C<@-> and C<@+>
747arrays. C<$-[0]> is the position of the start of the entire match and
748C<$+[0]> is the position of the end. Similarly, C<$-[n]> is the
749position of the start of the C<$n> match and C<$+[n]> is the position
750of the end. If C<$n> is undefined, so are C<$-[n]> and C<$+[n]>. Then
751this code
752
753 $x = "Mmm...donut, thought Homer";
754 $x =~ /^(Mmm|Yech)\.\.\.(donut|peas)/; # matches
755 foreach $expr (1..$#-) {
756 print "Match $expr: '${$expr}' at position ($-[$expr],$+[$expr])\n";
757 }
758
759prints
760
761 Match 1: 'Mmm' at position (0,3)
762 Match 2: 'donut' at position (6,11)
763
764Even if there are no groupings in a regexp, it is still possible to
765find out what exactly matched in a string. If you use them, perl
766will set C<$`> to the part of the string before the match, will set C<$&>
767to the part of the string that matched, and will set C<$'> to the part
768of the string after the match. An example:
769
770 $x = "the cat caught the mouse";
771 $x =~ /cat/; # $` = 'the ', $& = 'cat', $' = ' caught the mouse'
772 $x =~ /the/; # $` = '', $& = 'the', $' = ' cat caught the mouse'
773
774In the second match, S<C<$` = ''> > because the regexp matched at the
775first character position in the string and stopped, it never saw the
776second 'the'. It is important to note that using C<$`> and C<$'>
a6b2f353 777slows down regexp matching quite a bit, and C< $& > slows it down to a
47f9c88b 778lesser extent, because if they are used in one regexp in a program,
779they are generated for <all> regexps in the program. So if raw
780performance is a goal of your application, they should be avoided.
781If you need them, use C<@-> and C<@+> instead:
782
783 $` is the same as substr( $x, 0, $-[0] )
784 $& is the same as substr( $x, $-[0], $+[0]-$-[0] )
785 $' is the same as substr( $x, $+[0] )
786
787=head2 Matching repetitions
788
789The examples in the previous section display an annoying weakness. We
790were only matching 3-letter words, or syllables of 4 letters or
791less. We'd like to be able to match words or syllables of any length,
792without writing out tedious alternatives like
793C<\w\w\w\w|\w\w\w|\w\w|\w>.
794
795This is exactly the problem the B<quantifier> metacharacters C<?>,
796C<*>, C<+>, and C<{}> were created for. They allow us to determine the
797number of repeats of a portion of a regexp we consider to be a
798match. Quantifiers are put immediately after the character, character
799class, or grouping that we want to specify. They have the following
800meanings:
801
802=over 4
803
551e1d92 804=item *
47f9c88b 805
551e1d92 806C<a?> = match 'a' 1 or 0 times
47f9c88b 807
551e1d92 808=item *
809
810C<a*> = match 'a' 0 or more times, i.e., any number of times
811
812=item *
47f9c88b 813
551e1d92 814C<a+> = match 'a' 1 or more times, i.e., at least once
815
816=item *
817
818C<a{n,m}> = match at least C<n> times, but not more than C<m>
47f9c88b 819times.
820
551e1d92 821=item *
822
823C<a{n,}> = match at least C<n> or more times
824
825=item *
47f9c88b 826
551e1d92 827C<a{n}> = match exactly C<n> times
47f9c88b 828
829=back
830
831Here are some examples:
832
833 /[a-z]+\s+\d*/; # match a lowercase word, at least some space, and
834 # any number of digits
835 /(\w+)\s+\1/; # match doubled words of arbitrary length
836 /y(es)?/i; # matches 'y', 'Y', or a case-insensitive 'yes'
837 $year =~ /\d{2,4}/; # make sure year is at least 2 but not more
838 # than 4 digits
839 $year =~ /\d{4}|\d{2}/; # better match; throw out 3 digit dates
840 $year =~ /\d{2}(\d{2})?/; # same thing written differently. However,
841 # this produces $1 and the other does not.
842
843 % simple_grep '^(\w+)\1$' /usr/dict/words # isn't this easier?
844 beriberi
845 booboo
846 coco
847 mama
848 murmur
849 papa
850
851For all of these quantifiers, perl will try to match as much of the
852string as possible, while still allowing the regexp to succeed. Thus
853with C</a?.../>, perl will first try to match the regexp with the C<a>
854present; if that fails, perl will try to match the regexp without the
855C<a> present. For the quantifier C<*>, we get the following:
856
857 $x = "the cat in the hat";
858 $x =~ /^(.*)(cat)(.*)$/; # matches,
859 # $1 = 'the '
860 # $2 = 'cat'
861 # $3 = ' in the hat'
862
863Which is what we might expect, the match finds the only C<cat> in the
864string and locks onto it. Consider, however, this regexp:
865
866 $x =~ /^(.*)(at)(.*)$/; # matches,
867 # $1 = 'the cat in the h'
868 # $2 = 'at'
869 # $3 = '' (0 matches)
870
871One might initially guess that perl would find the C<at> in C<cat> and
872stop there, but that wouldn't give the longest possible string to the
873first quantifier C<.*>. Instead, the first quantifier C<.*> grabs as
874much of the string as possible while still having the regexp match. In
a6b2f353 875this example, that means having the C<at> sequence with the final C<at>
47f9c88b 876in the string. The other important principle illustrated here is that
877when there are two or more elements in a regexp, the I<leftmost>
878quantifier, if there is one, gets to grab as much the string as
879possible, leaving the rest of the regexp to fight over scraps. Thus in
880our example, the first quantifier C<.*> grabs most of the string, while
881the second quantifier C<.*> gets the empty string. Quantifiers that
882grab as much of the string as possible are called B<maximal match> or
883B<greedy> quantifiers.
884
885When a regexp can match a string in several different ways, we can use
886the principles above to predict which way the regexp will match:
887
888=over 4
889
890=item *
551e1d92 891
47f9c88b 892Principle 0: Taken as a whole, any regexp will be matched at the
893earliest possible position in the string.
894
895=item *
551e1d92 896
47f9c88b 897Principle 1: In an alternation C<a|b|c...>, the leftmost alternative
898that allows a match for the whole regexp will be the one used.
899
900=item *
551e1d92 901
47f9c88b 902Principle 2: The maximal matching quantifiers C<?>, C<*>, C<+> and
903C<{n,m}> will in general match as much of the string as possible while
904still allowing the whole regexp to match.
905
906=item *
551e1d92 907
47f9c88b 908Principle 3: If there are two or more elements in a regexp, the
909leftmost greedy quantifier, if any, will match as much of the string
910as possible while still allowing the whole regexp to match. The next
911leftmost greedy quantifier, if any, will try to match as much of the
912string remaining available to it as possible, while still allowing the
913whole regexp to match. And so on, until all the regexp elements are
914satisfied.
915
916=back
917
918As we have seen above, Principle 0 overrides the others - the regexp
919will be matched as early as possible, with the other principles
920determining how the regexp matches at that earliest character
921position.
922
923Here is an example of these principles in action:
924
925 $x = "The programming republic of Perl";
926 $x =~ /^(.+)(e|r)(.*)$/; # matches,
927 # $1 = 'The programming republic of Pe'
928 # $2 = 'r'
929 # $3 = 'l'
930
931This regexp matches at the earliest string position, C<'T'>. One
932might think that C<e>, being leftmost in the alternation, would be
933matched, but C<r> produces the longest string in the first quantifier.
934
935 $x =~ /(m{1,2})(.*)$/; # matches,
936 # $1 = 'mm'
937 # $2 = 'ing republic of Perl'
938
939Here, The earliest possible match is at the first C<'m'> in
940C<programming>. C<m{1,2}> is the first quantifier, so it gets to match
941a maximal C<mm>.
942
943 $x =~ /.*(m{1,2})(.*)$/; # matches,
944 # $1 = 'm'
945 # $2 = 'ing republic of Perl'
946
947Here, the regexp matches at the start of the string. The first
948quantifier C<.*> grabs as much as possible, leaving just a single
949C<'m'> for the second quantifier C<m{1,2}>.
950
951 $x =~ /(.?)(m{1,2})(.*)$/; # matches,
952 # $1 = 'a'
953 # $2 = 'mm'
954 # $3 = 'ing republic of Perl'
955
956Here, C<.?> eats its maximal one character at the earliest possible
957position in the string, C<'a'> in C<programming>, leaving C<m{1,2}>
958the opportunity to match both C<m>'s. Finally,
959
960 "aXXXb" =~ /(X*)/; # matches with $1 = ''
961
962because it can match zero copies of C<'X'> at the beginning of the
963string. If you definitely want to match at least one C<'X'>, use
964C<X+>, not C<X*>.
965
966Sometimes greed is not good. At times, we would like quantifiers to
967match a I<minimal> piece of string, rather than a maximal piece. For
968this purpose, Larry Wall created the S<B<minimal match> > or
969B<non-greedy> quantifiers C<??>,C<*?>, C<+?>, and C<{}?>. These are
970the usual quantifiers with a C<?> appended to them. They have the
971following meanings:
972
973=over 4
974
551e1d92 975=item *
976
977C<a??> = match 'a' 0 or 1 times. Try 0 first, then 1.
47f9c88b 978
551e1d92 979=item *
980
981C<a*?> = match 'a' 0 or more times, i.e., any number of times,
47f9c88b 982but as few times as possible
983
551e1d92 984=item *
985
986C<a+?> = match 'a' 1 or more times, i.e., at least once, but
47f9c88b 987as few times as possible
988
551e1d92 989=item *
990
991C<a{n,m}?> = match at least C<n> times, not more than C<m>
47f9c88b 992times, as few times as possible
993
551e1d92 994=item *
995
996C<a{n,}?> = match at least C<n> times, but as few times as
47f9c88b 997possible
998
551e1d92 999=item *
1000
1001C<a{n}?> = match exactly C<n> times. Because we match exactly
47f9c88b 1002C<n> times, C<a{n}?> is equivalent to C<a{n}> and is just there for
1003notational consistency.
1004
1005=back
1006
1007Let's look at the example above, but with minimal quantifiers:
1008
1009 $x = "The programming republic of Perl";
1010 $x =~ /^(.+?)(e|r)(.*)$/; # matches,
1011 # $1 = 'Th'
1012 # $2 = 'e'
1013 # $3 = ' programming republic of Perl'
1014
1015The minimal string that will allow both the start of the string C<^>
1016and the alternation to match is C<Th>, with the alternation C<e|r>
1017matching C<e>. The second quantifier C<.*> is free to gobble up the
1018rest of the string.
1019
1020 $x =~ /(m{1,2}?)(.*?)$/; # matches,
1021 # $1 = 'm'
1022 # $2 = 'ming republic of Perl'
1023
1024The first string position that this regexp can match is at the first
1025C<'m'> in C<programming>. At this position, the minimal C<m{1,2}?>
1026matches just one C<'m'>. Although the second quantifier C<.*?> would
1027prefer to match no characters, it is constrained by the end-of-string
1028anchor C<$> to match the rest of the string.
1029
1030 $x =~ /(.*?)(m{1,2}?)(.*)$/; # matches,
1031 # $1 = 'The progra'
1032 # $2 = 'm'
1033 # $3 = 'ming republic of Perl'
1034
1035In this regexp, you might expect the first minimal quantifier C<.*?>
1036to match the empty string, because it is not constrained by a C<^>
1037anchor to match the beginning of the word. Principle 0 applies here,
1038however. Because it is possible for the whole regexp to match at the
1039start of the string, it I<will> match at the start of the string. Thus
1040the first quantifier has to match everything up to the first C<m>. The
1041second minimal quantifier matches just one C<m> and the third
1042quantifier matches the rest of the string.
1043
1044 $x =~ /(.??)(m{1,2})(.*)$/; # matches,
1045 # $1 = 'a'
1046 # $2 = 'mm'
1047 # $3 = 'ing republic of Perl'
1048
1049Just as in the previous regexp, the first quantifier C<.??> can match
1050earliest at position C<'a'>, so it does. The second quantifier is
1051greedy, so it matches C<mm>, and the third matches the rest of the
1052string.
1053
1054We can modify principle 3 above to take into account non-greedy
1055quantifiers:
1056
1057=over 4
1058
1059=item *
551e1d92 1060
47f9c88b 1061Principle 3: If there are two or more elements in a regexp, the
1062leftmost greedy (non-greedy) quantifier, if any, will match as much
1063(little) of the string as possible while still allowing the whole
1064regexp to match. The next leftmost greedy (non-greedy) quantifier, if
1065any, will try to match as much (little) of the string remaining
1066available to it as possible, while still allowing the whole regexp to
1067match. And so on, until all the regexp elements are satisfied.
1068
1069=back
1070
1071Just like alternation, quantifiers are also susceptible to
1072backtracking. Here is a step-by-step analysis of the example
1073
1074 $x = "the cat in the hat";
1075 $x =~ /^(.*)(at)(.*)$/; # matches,
1076 # $1 = 'the cat in the h'
1077 # $2 = 'at'
1078 # $3 = '' (0 matches)
1079
1080=over 4
1081
551e1d92 1082=item 0
1083
1084Start with the first letter in the string 't'.
47f9c88b 1085
551e1d92 1086=item 1
1087
1088The first quantifier '.*' starts out by matching the whole
47f9c88b 1089string 'the cat in the hat'.
1090
551e1d92 1091=item 2
1092
1093'a' in the regexp element 'at' doesn't match the end of the
47f9c88b 1094string. Backtrack one character.
1095
551e1d92 1096=item 3
1097
1098'a' in the regexp element 'at' still doesn't match the last
47f9c88b 1099letter of the string 't', so backtrack one more character.
1100
551e1d92 1101=item 4
1102
1103Now we can match the 'a' and the 't'.
47f9c88b 1104
551e1d92 1105=item 5
1106
1107Move on to the third element '.*'. Since we are at the end of
47f9c88b 1108the string and '.*' can match 0 times, assign it the empty string.
1109
551e1d92 1110=item 6
1111
1112We are done!
47f9c88b 1113
1114=back
1115
1116Most of the time, all this moving forward and backtracking happens
1117quickly and searching is fast. There are some pathological regexps,
1118however, whose execution time exponentially grows with the size of the
1119string. A typical structure that blows up in your face is of the form
1120
1121 /(a|b+)*/;
1122
1123The problem is the nested indeterminate quantifiers. There are many
1124different ways of partitioning a string of length n between the C<+>
1125and C<*>: one repetition with C<b+> of length n, two repetitions with
1126the first C<b+> length k and the second with length n-k, m repetitions
1127whose bits add up to length n, etc. In fact there are an exponential
1128number of ways to partition a string as a function of length. A
1129regexp may get lucky and match early in the process, but if there is
1130no match, perl will try I<every> possibility before giving up. So be
1131careful with nested C<*>'s, C<{n,m}>'s, and C<+>'s. The book
1132I<Mastering regular expressions> by Jeffrey Friedl gives a wonderful
1133discussion of this and other efficiency issues.
1134
1135=head2 Building a regexp
1136
1137At this point, we have all the basic regexp concepts covered, so let's
1138give a more involved example of a regular expression. We will build a
1139regexp that matches numbers.
1140
1141The first task in building a regexp is to decide what we want to match
1142and what we want to exclude. In our case, we want to match both
1143integers and floating point numbers and we want to reject any string
1144that isn't a number.
1145
1146The next task is to break the problem down into smaller problems that
1147are easily converted into a regexp.
1148
1149The simplest case is integers. These consist of a sequence of digits,
1150with an optional sign in front. The digits we can represent with
1151C<\d+> and the sign can be matched with C<[+-]>. Thus the integer
1152regexp is
1153
1154 /[+-]?\d+/; # matches integers
1155
1156A floating point number potentially has a sign, an integral part, a
1157decimal point, a fractional part, and an exponent. One or more of these
1158parts is optional, so we need to check out the different
1159possibilities. Floating point numbers which are in proper form include
1160123., 0.345, .34, -1e6, and 25.4E-72. As with integers, the sign out
1161front is completely optional and can be matched by C<[+-]?>. We can
1162see that if there is no exponent, floating point numbers must have a
1163decimal point, otherwise they are integers. We might be tempted to
1164model these with C<\d*\.\d*>, but this would also match just a single
1165decimal point, which is not a number. So the three cases of floating
1166point number sans exponent are
1167
1168 /[+-]?\d+\./; # 1., 321., etc.
1169 /[+-]?\.\d+/; # .1, .234, etc.
1170 /[+-]?\d+\.\d+/; # 1.0, 30.56, etc.
1171
1172These can be combined into a single regexp with a three-way alternation:
1173
1174 /[+-]?(\d+\.\d+|\d+\.|\.\d+)/; # floating point, no exponent
1175
1176In this alternation, it is important to put C<'\d+\.\d+'> before
1177C<'\d+\.'>. If C<'\d+\.'> were first, the regexp would happily match that
1178and ignore the fractional part of the number.
1179
1180Now consider floating point numbers with exponents. The key
1181observation here is that I<both> integers and numbers with decimal
1182points are allowed in front of an exponent. Then exponents, like the
1183overall sign, are independent of whether we are matching numbers with
1184or without decimal points, and can be 'decoupled' from the
1185mantissa. The overall form of the regexp now becomes clear:
1186
1187 /^(optional sign)(integer | f.p. mantissa)(optional exponent)$/;
1188
1189The exponent is an C<e> or C<E>, followed by an integer. So the
1190exponent regexp is
1191
1192 /[eE][+-]?\d+/; # exponent
1193
1194Putting all the parts together, we get a regexp that matches numbers:
1195
1196 /^[+-]?(\d+\.\d+|\d+\.|\.\d+|\d+)([eE][+-]?\d+)?$/; # Ta da!
1197
1198Long regexps like this may impress your friends, but can be hard to
1199decipher. In complex situations like this, the C<//x> modifier for a
1200match is invaluable. It allows one to put nearly arbitrary whitespace
1201and comments into a regexp without affecting their meaning. Using it,
1202we can rewrite our 'extended' regexp in the more pleasing form
1203
1204 /^
1205 [+-]? # first, match an optional sign
1206 ( # then match integers or f.p. mantissas:
1207 \d+\.\d+ # mantissa of the form a.b
1208 |\d+\. # mantissa of the form a.
1209 |\.\d+ # mantissa of the form .b
1210 |\d+ # integer of the form a
1211 )
1212 ([eE][+-]?\d+)? # finally, optionally match an exponent
1213 $/x;
1214
1215If whitespace is mostly irrelevant, how does one include space
1216characters in an extended regexp? The answer is to backslash it
1217S<C<'\ '> > or put it in a character class S<C<[ ]> >. The same thing
1218goes for pound signs, use C<\#> or C<[#]>. For instance, Perl allows
1219a space between the sign and the mantissa/integer, and we could add
1220this to our regexp as follows:
1221
1222 /^
1223 [+-]?\ * # first, match an optional sign *and space*
1224 ( # then match integers or f.p. mantissas:
1225 \d+\.\d+ # mantissa of the form a.b
1226 |\d+\. # mantissa of the form a.
1227 |\.\d+ # mantissa of the form .b
1228 |\d+ # integer of the form a
1229 )
1230 ([eE][+-]?\d+)? # finally, optionally match an exponent
1231 $/x;
1232
1233In this form, it is easier to see a way to simplify the
1234alternation. Alternatives 1, 2, and 4 all start with C<\d+>, so it
1235could be factored out:
1236
1237 /^
1238 [+-]?\ * # first, match an optional sign
1239 ( # then match integers or f.p. mantissas:
1240 \d+ # start out with a ...
1241 (
1242 \.\d* # mantissa of the form a.b or a.
1243 )? # ? takes care of integers of the form a
1244 |\.\d+ # mantissa of the form .b
1245 )
1246 ([eE][+-]?\d+)? # finally, optionally match an exponent
1247 $/x;
1248
1249or written in the compact form,
1250
1251 /^[+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?$/;
1252
1253This is our final regexp. To recap, we built a regexp by
1254
1255=over 4
1256
551e1d92 1257=item *
1258
1259specifying the task in detail,
47f9c88b 1260
551e1d92 1261=item *
1262
1263breaking down the problem into smaller parts,
1264
1265=item *
47f9c88b 1266
551e1d92 1267translating the small parts into regexps,
47f9c88b 1268
551e1d92 1269=item *
1270
1271combining the regexps,
1272
1273=item *
47f9c88b 1274
551e1d92 1275and optimizing the final combined regexp.
47f9c88b 1276
1277=back
1278
1279These are also the typical steps involved in writing a computer
1280program. This makes perfect sense, because regular expressions are
1281essentially programs written a little computer language that specifies
1282patterns.
1283
1284=head2 Using regular expressions in Perl
1285
1286The last topic of Part 1 briefly covers how regexps are used in Perl
1287programs. Where do they fit into Perl syntax?
1288
1289We have already introduced the matching operator in its default
1290C</regexp/> and arbitrary delimiter C<m!regexp!> forms. We have used
1291the binding operator C<=~> and its negation C<!~> to test for string
1292matches. Associated with the matching operator, we have discussed the
1293single line C<//s>, multi-line C<//m>, case-insensitive C<//i> and
1294extended C<//x> modifiers.
1295
1296There are a few more things you might want to know about matching
1297operators. First, we pointed out earlier that variables in regexps are
1298substituted before the regexp is evaluated:
1299
1300 $pattern = 'Seuss';
1301 while (<>) {
1302 print if /$pattern/;
1303 }
1304
1305This will print any lines containing the word C<Seuss>. It is not as
1306efficient as it could be, however, because perl has to re-evaluate
1307C<$pattern> each time through the loop. If C<$pattern> won't be
1308changing over the lifetime of the script, we can add the C<//o>
1309modifier, which directs perl to only perform variable substitutions
1310once:
1311
1312 #!/usr/bin/perl
1313 # Improved simple_grep
1314 $regexp = shift;
1315 while (<>) {
1316 print if /$regexp/o; # a good deal faster
1317 }
1318
1319If you change C<$pattern> after the first substitution happens, perl
1320will ignore it. If you don't want any substitutions at all, use the
1321special delimiter C<m''>:
1322
1323 $pattern = 'Seuss';
1324 while (<>) {
1325 print if m'$pattern'; # matches '$pattern', not 'Seuss'
1326 }
1327
1328C<m''> acts like single quotes on a regexp; all other C<m> delimiters
1329act like double quotes. If the regexp evaluates to the empty string,
1330the regexp in the I<last successful match> is used instead. So we have
1331
1332 "dog" =~ /d/; # 'd' matches
1333 "dogbert =~ //; # this matches the 'd' regexp used before
1334
1335The final two modifiers C<//g> and C<//c> concern multiple matches.
1336The modifier C<//g> stands for global matching and allows the the
1337matching operator to match within a string as many times as possible.
1338In scalar context, successive invocations against a string will have
1339`C<//g> jump from match to match, keeping track of position in the
1340string as it goes along. You can get or set the position with the
1341C<pos()> function.
1342
1343The use of C<//g> is shown in the following example. Suppose we have
1344a string that consists of words separated by spaces. If we know how
1345many words there are in advance, we could extract the words using
1346groupings:
1347
1348 $x = "cat dog house"; # 3 words
1349 $x =~ /^\s*(\w+)\s+(\w+)\s+(\w+)\s*$/; # matches,
1350 # $1 = 'cat'
1351 # $2 = 'dog'
1352 # $3 = 'house'
1353
1354But what if we had an indeterminate number of words? This is the sort
1355of task C<//g> was made for. To extract all words, form the simple
1356regexp C<(\w+)> and loop over all matches with C</(\w+)/g>:
1357
1358 while ($x =~ /(\w+)/g) {
1359 print "Word is $1, ends at position ", pos $x, "\n";
1360 }
1361
1362prints
1363
1364 Word is cat, ends at position 3
1365 Word is dog, ends at position 7
1366 Word is house, ends at position 13
1367
1368A failed match or changing the target string resets the position. If
1369you don't want the position reset after failure to match, add the
1370C<//c>, as in C</regexp/gc>. The current position in the string is
1371associated with the string, not the regexp. This means that different
1372strings have different positions and their respective positions can be
1373set or read independently.
1374
1375In list context, C<//g> returns a list of matched groupings, or if
1376there are no groupings, a list of matches to the whole regexp. So if
1377we wanted just the words, we could use
1378
1379 @words = ($x =~ /(\w+)/g); # matches,
1380 # $word[0] = 'cat'
1381 # $word[1] = 'dog'
1382 # $word[2] = 'house'
1383
1384Closely associated with the C<//g> modifier is the C<\G> anchor. The
1385C<\G> anchor matches at the point where the previous C<//g> match left
1386off. C<\G> allows us to easily do context-sensitive matching:
1387
1388 $metric = 1; # use metric units
1389 ...
1390 $x = <FILE>; # read in measurement
1391 $x =~ /^([+-]?\d+)\s*/g; # get magnitude
1392 $weight = $1;
1393 if ($metric) { # error checking
1394 print "Units error!" unless $x =~ /\Gkg\./g;
1395 }
1396 else {
1397 print "Units error!" unless $x =~ /\Glbs\./g;
1398 }
1399 $x =~ /\G\s+(widget|sprocket)/g; # continue processing
1400
1401The combination of C<//g> and C<\G> allows us to process the string a
1402bit at a time and use arbitrary Perl logic to decide what to do next.
1403
1404C<\G> is also invaluable in processing fixed length records with
1405regexps. Suppose we have a snippet of coding region DNA, encoded as
1406base pair letters C<ATCGTTGAAT...> and we want to find all the stop
1407codons C<TGA>. In a coding region, codons are 3-letter sequences, so
1408we can think of the DNA snippet as a sequence of 3-letter records. The
1409naive regexp
1410
1411 # expanded, this is "ATC GTT GAA TGC AAA TGA CAT GAC"
1412 $dna = "ATCGTTGAATGCAAATGACATGAC";
1413 $dna =~ /TGA/;
1414
1415doesn't work; it may match an C<TGA>, but there is no guarantee that
1416the match is aligned with codon boundaries, e.g., the substring
1417S<C<GTT GAA> > gives a match. A better solution is
1418
1419 while ($dna =~ /(\w\w\w)*?TGA/g) { # note the minimal *?
1420 print "Got a TGA stop codon at position ", pos $dna, "\n";
1421 }
1422
1423which prints
1424
1425 Got a TGA stop codon at position 18
1426 Got a TGA stop codon at position 23
1427
1428Position 18 is good, but position 23 is bogus. What happened?
1429
1430The answer is that our regexp works well until we get past the last
1431real match. Then the regexp will fail to match a synchronized C<TGA>
1432and start stepping ahead one character position at a time, not what we
1433want. The solution is to use C<\G> to anchor the match to the codon
1434alignment:
1435
1436 while ($dna =~ /\G(\w\w\w)*?TGA/g) {
1437 print "Got a TGA stop codon at position ", pos $dna, "\n";
1438 }
1439
1440This prints
1441
1442 Got a TGA stop codon at position 18
1443
1444which is the correct answer. This example illustrates that it is
1445important not only to match what is desired, but to reject what is not
1446desired.
1447
1448B<search and replace>
1449
1450Regular expressions also play a big role in B<search and replace>
1451operations in Perl. Search and replace is accomplished with the
1452C<s///> operator. The general form is
1453C<s/regexp/replacement/modifiers>, with everything we know about
1454regexps and modifiers applying in this case as well. The
1455C<replacement> is a Perl double quoted string that replaces in the
1456string whatever is matched with the C<regexp>. The operator C<=~> is
1457also used here to associate a string with C<s///>. If matching
1458against C<$_>, the S<C<$_ =~> > can be dropped. If there is a match,
1459C<s///> returns the number of substitutions made, otherwise it returns
1460false. Here are a few examples:
1461
1462 $x = "Time to feed the cat!";
1463 $x =~ s/cat/hacker/; # $x contains "Time to feed the hacker!"
1464 if ($x =~ s/^(Time.*hacker)!$/$1 now!/) {
1465 $more_insistent = 1;
1466 }
1467 $y = "'quoted words'";
1468 $y =~ s/^'(.*)'$/$1/; # strip single quotes,
1469 # $y contains "quoted words"
1470
1471In the last example, the whole string was matched, but only the part
1472inside the single quotes was grouped. With the C<s///> operator, the
1473matched variables C<$1>, C<$2>, etc. are immediately available for use
1474in the replacement expression, so we use C<$1> to replace the quoted
1475string with just what was quoted. With the global modifier, C<s///g>
1476will search and replace all occurrences of the regexp in the string:
1477
1478 $x = "I batted 4 for 4";
1479 $x =~ s/4/four/; # doesn't do it all:
1480 # $x contains "I batted four for 4"
1481 $x = "I batted 4 for 4";
1482 $x =~ s/4/four/g; # does it all:
1483 # $x contains "I batted four for four"
1484
1485If you prefer 'regex' over 'regexp' in this tutorial, you could use
1486the following program to replace it:
1487
1488 % cat > simple_replace
1489 #!/usr/bin/perl
1490 $regexp = shift;
1491 $replacement = shift;
1492 while (<>) {
1493 s/$regexp/$replacement/go;
1494 print;
1495 }
1496 ^D
1497
1498 % simple_replace regexp regex perlretut.pod
1499
1500In C<simple_replace> we used the C<s///g> modifier to replace all
1501occurrences of the regexp on each line and the C<s///o> modifier to
1502compile the regexp only once. As with C<simple_grep>, both the
1503C<print> and the C<s/$regexp/$replacement/go> use C<$_> implicitly.
1504
1505A modifier available specifically to search and replace is the
1506C<s///e> evaluation modifier. C<s///e> wraps an C<eval{...}> around
1507the replacement string and the evaluated result is substituted for the
1508matched substring. C<s///e> is useful if you need to do a bit of
1509computation in the process of replacing text. This example counts
1510character frequencies in a line:
1511
1512 $x = "Bill the cat";
1513 $x =~ s/(.)/$chars{$1}++;$1/eg; # final $1 replaces char with itself
1514 print "frequency of '$_' is $chars{$_}\n"
1515 foreach (sort {$chars{$b} <=> $chars{$a}} keys %chars);
1516
1517This prints
1518
1519 frequency of ' ' is 2
1520 frequency of 't' is 2
1521 frequency of 'l' is 2
1522 frequency of 'B' is 1
1523 frequency of 'c' is 1
1524 frequency of 'e' is 1
1525 frequency of 'h' is 1
1526 frequency of 'i' is 1
1527 frequency of 'a' is 1
1528
1529As with the match C<m//> operator, C<s///> can use other delimiters,
1530such as C<s!!!> and C<s{}{}>, and even C<s{}//>. If single quotes are
1531used C<s'''>, then the regexp and replacement are treated as single
1532quoted strings and there are no substitutions. C<s///> in list context
1533returns the same thing as in scalar context, i.e., the number of
1534matches.
1535
1536B<The split operator>
1537
1538The B<C<split> > function can also optionally use a matching operator
1539C<m//> to split a string. C<split /regexp/, string, limit> splits
1540C<string> into a list of substrings and returns that list. The regexp
1541is used to match the character sequence that the C<string> is split
1542with respect to. The C<limit>, if present, constrains splitting into
1543no more than C<limit> number of strings. For example, to split a
1544string into words, use
1545
1546 $x = "Calvin and Hobbes";
1547 @words = split /\s+/, $x; # $word[0] = 'Calvin'
1548 # $word[1] = 'and'
1549 # $word[2] = 'Hobbes'
1550
1551If the empty regexp C<//> is used, the regexp always matches and
1552the string is split into individual characters. If the regexp has
1553groupings, then list produced contains the matched substrings from the
1554groupings as well. For instance,
1555
1556 $x = "/usr/bin/perl";
1557 @dirs = split m!/!, $x; # $dirs[0] = ''
1558 # $dirs[1] = 'usr'
1559 # $dirs[2] = 'bin'
1560 # $dirs[3] = 'perl'
1561 @parts = split m!(/)!, $x; # $parts[0] = ''
1562 # $parts[1] = '/'
1563 # $parts[2] = 'usr'
1564 # $parts[3] = '/'
1565 # $parts[4] = 'bin'
1566 # $parts[5] = '/'
1567 # $parts[6] = 'perl'
1568
1569Since the first character of $x matched the regexp, C<split> prepended
1570an empty initial element to the list.
1571
1572If you have read this far, congratulations! You now have all the basic
1573tools needed to use regular expressions to solve a wide range of text
1574processing problems. If this is your first time through the tutorial,
1575why not stop here and play around with regexps a while... S<Part 2>
1576concerns the more esoteric aspects of regular expressions and those
1577concepts certainly aren't needed right at the start.
1578
1579=head1 Part 2: Power tools
1580
1581OK, you know the basics of regexps and you want to know more. If
1582matching regular expressions is analogous to a walk in the woods, then
1583the tools discussed in Part 1 are analogous to topo maps and a
1584compass, basic tools we use all the time. Most of the tools in part 2
1585are are analogous to flare guns and satellite phones. They aren't used
1586too often on a hike, but when we are stuck, they can be invaluable.
1587
1588What follows are the more advanced, less used, or sometimes esoteric
1589capabilities of perl regexps. In Part 2, we will assume you are
1590comfortable with the basics and concentrate on the new features.
1591
1592=head2 More on characters, strings, and character classes
1593
1594There are a number of escape sequences and character classes that we
1595haven't covered yet.
1596
1597There are several escape sequences that convert characters or strings
1598between upper and lower case. C<\l> and C<\u> convert the next
1599character to lower or upper case, respectively:
1600
1601 $x = "perl";
1602 $string =~ /\u$x/; # matches 'Perl' in $string
1603 $x = "M(rs?|s)\\."; # note the double backslash
1604 $string =~ /\l$x/; # matches 'mr.', 'mrs.', and 'ms.',
1605
1606C<\L> and C<\U> converts a whole substring, delimited by C<\L> or
1607C<\U> and C<\E>, to lower or upper case:
1608
1609 $x = "This word is in lower case:\L SHOUT\E";
1610 $x =~ /shout/; # matches
1611 $x = "I STILL KEYPUNCH CARDS FOR MY 360"
1612 $x =~ /\Ukeypunch/; # matches punch card string
1613
1614If there is no C<\E>, case is converted until the end of the
1615string. The regexps C<\L\u$word> or C<\u\L$word> convert the first
1616character of C<$word> to uppercase and the rest of the characters to
1617lowercase.
1618
1619Control characters can be escaped with C<\c>, so that a control-Z
1620character would be matched with C<\cZ>. The escape sequence
1621C<\Q>...C<\E> quotes, or protects most non-alphabetic characters. For
1622instance,
1623
1624 $x = "\QThat !^*&%~& cat!";
1625 $x =~ /\Q!^*&%~&\E/; # check for rough language
1626
1627It does not protect C<$> or C<@>, so that variables can still be
1628substituted.
1629
1630With the advent of 5.6.0, perl regexps can handle more than just the
1631standard ASCII character set. Perl now supports B<Unicode>, a standard
1632for encoding the character sets from many of the world's written
1633languages. Unicode does this by allowing characters to be more than
1634one byte wide. Perl uses the UTF-8 encoding, in which ASCII characters
1635are still encoded as one byte, but characters greater than C<chr(127)>
1636may be stored as two or more bytes.
1637
1638What does this mean for regexps? Well, regexp users don't need to know
1639much about perl's internal representation of strings. But they do need
1640to know 1) how to represent Unicode characters in a regexp and 2) when
1641a matching operation will treat the string to be searched as a
1642sequence of bytes (the old way) or as a sequence of Unicode characters
1643(the new way). The answer to 1) is that Unicode characters greater
1644than C<chr(127)> may be represented using the C<\x{hex}> notation,
1645with C<hex> a hexadecimal integer:
1646
1647 use utf8; # We will be doing Unicode processing
1648 /\x{263a}/; # match a Unicode smiley face :)
1649
1650Unicode characters in the range of 128-255 use two hexadecimal digits
1651with braces: C<\x{ab}>. Note that this is different than C<\xab>,
1652which is just a hexadecimal byte with no Unicode
1653significance.
1654
1655Figuring out the hexadecimal sequence of a Unicode character you want
1656or deciphering someone else's hexadecimal Unicode regexp is about as
1657much fun as programming in machine code. So another way to specify
1658Unicode characters is to use the S<B<named character> > escape
1659sequence C<\N{name}>. C<name> is a name for the Unicode character, as
55eda711 1660specified in the Unicode standard. For instance, if we wanted to
1661represent or match the astrological sign for the planet Mercury, we
1662could use
47f9c88b 1663
1664 use utf8; # We will be doing Unicode processing
1665 use charnames ":full"; # use named chars with Unicode full names
1666 $x = "abc\N{MERCURY}def";
1667 $x =~ /\N{MERCURY}/; # matches
1668
1669One can also use short names or restrict names to a certain alphabet:
1670
1671 use utf8; # We will be doing Unicode processing
1672
1673 use charnames ':full';
1674 print "\N{GREEK SMALL LETTER SIGMA} is called sigma.\n";
1675
1676 use charnames ":short";
1677 print "\N{greek:Sigma} is an upper-case sigma.\n";
1678
1679 use charnames qw(greek);
1680 print "\N{sigma} is Greek sigma\n";
1681
1682A list of full names is found in the file Names.txt in the
1683lib/perl5/5.6.0/unicode directory.
1684
1685The answer to requirement 2), as of 5.6.0, is that if a regexp
1686contains Unicode characters, the string is searched as a sequence of
1687Unicode characters. Otherwise, the string is searched as a sequence of
1688bytes. If the string is being searched as a sequence of Unicode
1689characters, but matching a single byte is required, we can use the C<\C>
1690escape sequence. C<\C> is a character class akin to C<.> except that
1691it matches I<any> byte 0-255. So
1692
1693 use utf8; # We will be doing Unicode processing
1694 use charnames ":full"; # use named chars with Unicode full names
1695 $x = "a";
1696 $x =~ /\C/; # matches 'a', eats one byte
1697 $x = "";
1698 $x =~ /\C/; # doesn't match, no bytes to match
1699 $x = "\N{MERCURY}"; # two-byte Unicode character
1700 $x =~ /\C/; # matches, but dangerous!
1701
1702The last regexp matches, but is dangerous because the string
a6b2f353 1703I<character> position is no longer synchronized to the string I<byte>
47f9c88b 1704position. This generates the warning 'Malformed UTF-8
1705character'. C<\C> is best used for matching the binary data in strings
1706with binary data intermixed with Unicode characters.
1707
1708Let us now discuss the rest of the character classes. Just as with
1709Unicode characters, there are named Unicode character classes
1710represented by the C<\p{name}> escape sequence. Closely associated is
1711the C<\P{name}> character class, which is the negation of the
1712C<\p{name}> class. For example, to match lower and uppercase
1713characters,
1714
1715 use utf8; # We will be doing Unicode processing
1716 use charnames ":full"; # use named chars with Unicode full names
1717 $x = "BOB";
1718 $x =~ /^\p{IsUpper}/; # matches, uppercase char class
1719 $x =~ /^\P{IsUpper}/; # doesn't match, char class sans uppercase
1720 $x =~ /^\p{IsLower}/; # doesn't match, lowercase char class
1721 $x =~ /^\P{IsLower}/; # matches, char class sans lowercase
1722
86929931 1723Here is the association between some Perl named classes and the
1724traditional Unicode classes:
47f9c88b 1725
86929931 1726 Perl class name Unicode class name or regular expression
47f9c88b 1727
f5868911 1728 IsAlpha /^[LM]/
1729 IsAlnum /^[LMN]/
1730 IsASCII $code <= 127
1731 IsCntrl /^C/
1732 IsBlank $code =~ /^(0020|0009)$/ || /^Z[^lp]/
47f9c88b 1733 IsDigit Nd
f5868911 1734 IsGraph /^([LMNPS]|Co)/
47f9c88b 1735 IsLower Ll
f5868911 1736 IsPrint /^([LMNPS]|Co|Zs)/
1737 IsPunct /^P/
1738 IsSpace /^Z/ || ($code =~ /^(0009|000A|000B|000C|000D)$/
1739 IsSpacePerl /^Z/ || ($code =~ /^(0009|000A|000C|000D)$/
1740 IsUpper /^L[ut]/
1741 IsWord /^[LMN]/ || $code eq "005F"
47f9c88b 1742 IsXDigit $code =~ /^00(3[0-9]|[46][1-6])$/
1743
86929931 1744You can also use the official Unicode class names with the C<\p> and
1745C<\P>, like C<\p{L}> for Unicode 'letters', or C<\p{Lu}> for uppercase
1746letters, or C<\P{Nd}> for non-digits. If a C<name> is just one
1747letter, the braces can be dropped. For instance, C<\pM> is the
1748character class of Unicode 'marks'.
47f9c88b 1749
1750C<\X> is an abbreviation for a character class sequence that includes
1751the Unicode 'combining character sequences'. A 'combining character
1752sequence' is a base character followed by any number of combining
1753characters. An example of a combining character is an accent. Using
1754the Unicode full names, e.g., S<C<A + COMBINING RING> > is a combining
1755character sequence with base character C<A> and combining character
1756S<C<COMBINING RING> >, which translates in Danish to A with the circle
1757atop it, as in the word Angstrom. C<\X> is equivalent to C<\PM\pM*}>,
1758i.e., a non-mark followed by one or more marks.
1759
1760As if all those classes weren't enough, Perl also defines POSIX style
1761character classes. These have the form C<[:name:]>, with C<name> the
aaa51d5e 1762name of the POSIX class. The POSIX classes are C<alpha>, C<alnum>,
1763C<ascii>, C<cntrl>, C<digit>, C<graph>, C<lower>, C<print>, C<punct>,
1764C<space>, C<upper>, and C<xdigit>, and two extensions, C<word> (a Perl
1765extension to match C<\w>), and C<blank> (a GNU extension). If C<utf8>
1766is being used, then these classes are defined the same as their
1767corresponding perl Unicode classes: C<[:upper:]> is the same as
1768C<\p{IsUpper}>, etc. The POSIX character classes, however, don't
1769require using C<utf8>. The C<[:digit:]>, C<[:word:]>, and
47f9c88b 1770C<[:space:]> correspond to the familiar C<\d>, C<\w>, and C<\s>
aaa51d5e 1771character classes. To negate a POSIX class, put a C<^> in front of
1772the name, so that, e.g., C<[:^digit:]> corresponds to C<\D> and under
47f9c88b 1773C<utf8>, C<\P{IsDigit}>. The Unicode and POSIX character classes can
1774be used just like C<\d>, both inside and outside of character classes:
1775
1776 /\s+[abc[:digit:]xyz]\s*/; # match a,b,c,x,y,z, or a digit
1777 /^=item\s[:digit:]/; # match '=item',
1778 # followed by a space and a digit
1779 use utf8;
1780 use charnames ":full";
1781 /\s+[abc\p{IsDigit}xyz]\s+/; # match a,b,c,x,y,z, or a digit
1782 /^=item\s\p{IsDigit}/; # match '=item',
1783 # followed by a space and a digit
1784
1785Whew! That is all the rest of the characters and character classes.
1786
1787=head2 Compiling and saving regular expressions
1788
1789In Part 1 we discussed the C<//o> modifier, which compiles a regexp
1790just once. This suggests that a compiled regexp is some data structure
1791that can be stored once and used again and again. The regexp quote
1792C<qr//> does exactly that: C<qr/string/> compiles the C<string> as a
1793regexp and transforms the result into a form that can be assigned to a
1794variable:
1795
1796 $reg = qr/foo+bar?/; # reg contains a compiled regexp
1797
1798Then C<$reg> can be used as a regexp:
1799
1800 $x = "fooooba";
1801 $x =~ $reg; # matches, just like /foo+bar?/
1802 $x =~ /$reg/; # same thing, alternate form
1803
1804C<$reg> can also be interpolated into a larger regexp:
1805
1806 $x =~ /(abc)?$reg/; # still matches
1807
1808As with the matching operator, the regexp quote can use different
1809delimiters, e.g., C<qr!!>, C<qr{}> and C<qr~~>. The single quote
1810delimiters C<qr''> prevent any interpolation from taking place.
1811
1812Pre-compiled regexps are useful for creating dynamic matches that
1813don't need to be recompiled each time they are encountered. Using
1814pre-compiled regexps, C<simple_grep> program can be expanded into a
1815program that matches multiple patterns:
1816
1817 % cat > multi_grep
1818 #!/usr/bin/perl
1819 # multi_grep - match any of <number> regexps
1820 # usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ...
1821
1822 $number = shift;
1823 $regexp[$_] = shift foreach (0..$number-1);
1824 @compiled = map qr/$_/, @regexp;
1825 while ($line = <>) {
1826 foreach $pattern (@compiled) {
1827 if ($line =~ /$pattern/) {
1828 print $line;
1829 last; # we matched, so move onto the next line
1830 }
1831 }
1832 }
1833 ^D
1834
1835 % multi_grep 2 last for multi_grep
1836 $regexp[$_] = shift foreach (0..$number-1);
1837 foreach $pattern (@compiled) {
1838 last;
1839
1840Storing pre-compiled regexps in an array C<@compiled> allows us to
1841simply loop through the regexps without any recompilation, thus gaining
1842flexibility without sacrificing speed.
1843
1844=head2 Embedding comments and modifiers in a regular expression
1845
1846Starting with this section, we will be discussing Perl's set of
1847B<extended patterns>. These are extensions to the traditional regular
1848expression syntax that provide powerful new tools for pattern
1849matching. We have already seen extensions in the form of the minimal
1850matching constructs C<??>, C<*?>, C<+?>, C<{n,m}?>, and C<{n,}?>. The
1851rest of the extensions below have the form C<(?char...)>, where the
1852C<char> is a character that determines the type of extension.
1853
1854The first extension is an embedded comment C<(?#text)>. This embeds a
1855comment into the regular expression without affecting its meaning. The
1856comment should not have any closing parentheses in the text. An
1857example is
1858
1859 /(?# Match an integer:)[+-]?\d+/;
1860
1861This style of commenting has been largely superseded by the raw,
1862freeform commenting that is allowed with the C<//x> modifier.
1863
1864The modifiers C<//i>, C<//m>, C<//s>, and C<//x> can also embedded in
1865a regexp using C<(?i)>, C<(?m)>, C<(?s)>, and C<(?x)>. For instance,
1866
1867 /(?i)yes/; # match 'yes' case insensitively
1868 /yes/i; # same thing
1869 /(?x)( # freeform version of an integer regexp
1870 [+-]? # match an optional sign
1871 \d+ # match a sequence of digits
1872 )
1873 /x;
1874
1875Embedded modifiers can have two important advantages over the usual
1876modifiers. Embedded modifiers allow a custom set of modifiers to
1877I<each> regexp pattern. This is great for matching an array of regexps
1878that must have different modifiers:
1879
1880 $pattern[0] = '(?i)doctor';
1881 $pattern[1] = 'Johnson';
1882 ...
1883 while (<>) {
1884 foreach $patt (@pattern) {
1885 print if /$patt/;
1886 }
1887 }
1888
1889The second advantage is that embedded modifiers only affect the regexp
1890inside the group the embedded modifier is contained in. So grouping
1891can be used to localize the modifier's effects:
1892
1893 /Answer: ((?i)yes)/; # matches 'Answer: yes', 'Answer: YES', etc.
1894
1895Embedded modifiers can also turn off any modifiers already present
1896by using, e.g., C<(?-i)>. Modifiers can also be combined into
1897a single expression, e.g., C<(?s-i)> turns on single line mode and
1898turns off case insensitivity.
1899
1900=head2 Non-capturing groupings
1901
1902We noted in Part 1 that groupings C<()> had two distinct functions: 1)
1903group regexp elements together as a single unit, and 2) extract, or
1904capture, substrings that matched the regexp in the
1905grouping. Non-capturing groupings, denoted by C<(?:regexp)>, allow the
1906regexp to be treated as a single unit, but don't extract substrings or
1907set matching variables C<$1>, etc. Both capturing and non-capturing
1908groupings are allowed to co-exist in the same regexp. Because there is
1909no extraction, non-capturing groupings are faster than capturing
1910groupings. Non-capturing groupings are also handy for choosing exactly
1911which parts of a regexp are to be extracted to matching variables:
1912
1913 # match a number, $1-$4 are set, but we only want $1
1914 /([+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?)/;
1915
1916 # match a number faster , only $1 is set
1917 /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE][+-]?\d+)?)/;
1918
1919 # match a number, get $1 = whole number, $2 = exponent
1920 /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE]([+-]?\d+))?)/;
1921
1922Non-capturing groupings are also useful for removing nuisance
1923elements gathered from a split operation:
1924
1925 $x = '12a34b5';
1926 @num = split /(a|b)/, $x; # @num = ('12','a','34','b','5')
1927 @num = split /(?:a|b)/, $x; # @num = ('12','34','5')
1928
1929Non-capturing groupings may also have embedded modifiers:
1930C<(?i-m:regexp)> is a non-capturing grouping that matches C<regexp>
1931case insensitively and turns off multi-line mode.
1932
1933=head2 Looking ahead and looking behind
1934
1935This section concerns the lookahead and lookbehind assertions. First,
1936a little background.
1937
1938In Perl regular expressions, most regexp elements 'eat up' a certain
1939amount of string when they match. For instance, the regexp element
1940C<[abc}]> eats up one character of the string when it matches, in the
1941sense that perl moves to the next character position in the string
1942after the match. There are some elements, however, that don't eat up
1943characters (advance the character position) if they match. The examples
1944we have seen so far are the anchors. The anchor C<^> matches the
1945beginning of the line, but doesn't eat any characters. Similarly, the
1946word boundary anchor C<\b> matches, e.g., if the character to the left
1947is a word character and the character to the right is a non-word
1948character, but it doesn't eat up any characters itself. Anchors are
1949examples of 'zero-width assertions'. Zero-width, because they consume
1950no characters, and assertions, because they test some property of the
1951string. In the context of our walk in the woods analogy to regexp
1952matching, most regexp elements move us along a trail, but anchors have
1953us stop a moment and check our surroundings. If the local environment
1954checks out, we can proceed forward. But if the local environment
1955doesn't satisfy us, we must backtrack.
1956
1957Checking the environment entails either looking ahead on the trail,
1958looking behind, or both. C<^> looks behind, to see that there are no
1959characters before. C<$> looks ahead, to see that there are no
1960characters after. C<\b> looks both ahead and behind, to see if the
1961characters on either side differ in their 'word'-ness.
1962
1963The lookahead and lookbehind assertions are generalizations of the
1964anchor concept. Lookahead and lookbehind are zero-width assertions
1965that let us specify which characters we want to test for. The
1966lookahead assertion is denoted by C<(?=regexp)> and the lookbehind
a6b2f353 1967assertion is denoted by C<< (?<=fixed-regexp) >>. Some examples are
47f9c88b 1968
1969 $x = "I catch the housecat 'Tom-cat' with catnip";
1970 $x =~ /cat(?=\s+)/; # matches 'cat' in 'housecat'
1971 @catwords = ($x =~ /(?<=\s)cat\w+/g); # matches,
1972 # $catwords[0] = 'catch'
1973 # $catwords[1] = 'catnip'
1974 $x =~ /\bcat\b/; # matches 'cat' in 'Tom-cat'
1975 $x =~ /(?<=\s)cat(?=\s)/; # doesn't match; no isolated 'cat' in
1976 # middle of $x
1977
a6b2f353 1978Note that the parentheses in C<(?=regexp)> and C<< (?<=regexp) >> are
47f9c88b 1979non-capturing, since these are zero-width assertions. Thus in the
1980second regexp, the substrings captured are those of the whole regexp
a6b2f353 1981itself. Lookahead C<(?=regexp)> can match arbitrary regexps, but
1982lookbehind C<< (?<=fixed-regexp) >> only works for regexps of fixed
1983width, i.e., a fixed number of characters long. Thus
1984C<< (?<=(ab|bc)) >> is fine, but C<< (?<=(ab)*) >> is not. The
1985negated versions of the lookahead and lookbehind assertions are
1986denoted by C<(?!regexp)> and C<< (?<!fixed-regexp) >> respectively.
1987They evaluate true if the regexps do I<not> match:
47f9c88b 1988
1989 $x = "foobar";
1990 $x =~ /foo(?!bar)/; # doesn't match, 'bar' follows 'foo'
1991 $x =~ /foo(?!baz)/; # matches, 'baz' doesn't follow 'foo'
1992 $x =~ /(?<!\s)foo/; # matches, there is no \s before 'foo'
1993
1994=head2 Using independent subexpressions to prevent backtracking
1995
1996The last few extended patterns in this tutorial are experimental as of
19975.6.0. Play with them, use them in some code, but don't rely on them
1998just yet for production code.
1999
2000S<B<Independent subexpressions> > are regular expressions, in the
2001context of a larger regular expression, that function independently of
2002the larger regular expression. That is, they consume as much or as
2003little of the string as they wish without regard for the ability of
2004the larger regexp to match. Independent subexpressions are represented
2005by C<< (?>regexp) >>. We can illustrate their behavior by first
2006considering an ordinary regexp:
2007
2008 $x = "ab";
2009 $x =~ /a*ab/; # matches
2010
2011This obviously matches, but in the process of matching, the
2012subexpression C<a*> first grabbed the C<a>. Doing so, however,
2013wouldn't allow the whole regexp to match, so after backtracking, C<a*>
2014eventually gave back the C<a> and matched the empty string. Here, what
2015C<a*> matched was I<dependent> on what the rest of the regexp matched.
2016
2017Contrast that with an independent subexpression:
2018
2019 $x =~ /(?>a*)ab/; # doesn't match!
2020
2021The independent subexpression C<< (?>a*) >> doesn't care about the rest
2022of the regexp, so it sees an C<a> and grabs it. Then the rest of the
2023regexp C<ab> cannot match. Because C<< (?>a*) >> is independent, there
2024is no backtracking and and the independent subexpression does not give
2025up its C<a>. Thus the match of the regexp as a whole fails. A similar
2026behavior occurs with completely independent regexps:
2027
2028 $x = "ab";
2029 $x =~ /a*/g; # matches, eats an 'a'
2030 $x =~ /\Gab/g; # doesn't match, no 'a' available
2031
2032Here C<//g> and C<\G> create a 'tag team' handoff of the string from
2033one regexp to the other. Regexps with an independent subexpression are
2034much like this, with a handoff of the string to the independent
2035subexpression, and a handoff of the string back to the enclosing
2036regexp.
2037
2038The ability of an independent subexpression to prevent backtracking
2039can be quite useful. Suppose we want to match a non-empty string
2040enclosed in parentheses up to two levels deep. Then the following
2041regexp matches:
2042
2043 $x = "abc(de(fg)h"; # unbalanced parentheses
2044 $x =~ /\( ( [^()]+ | \([^()]*\) )+ \)/x;
2045
2046The regexp matches an open parenthesis, one or more copies of an
2047alternation, and a close parenthesis. The alternation is two-way, with
2048the first alternative C<[^()]+> matching a substring with no
2049parentheses and the second alternative C<\([^()]*\)> matching a
2050substring delimited by parentheses. The problem with this regexp is
2051that it is pathological: it has nested indeterminate quantifiers
2052 of the form C<(a+|b)+>. We discussed in Part 1 how nested quantifiers
2053like this could take an exponentially long time to execute if there
2054was no match possible. To prevent the exponential blowup, we need to
2055prevent useless backtracking at some point. This can be done by
2056enclosing the inner quantifier as an independent subexpression:
2057
2058 $x =~ /\( ( (?>[^()]+) | \([^()]*\) )+ \)/x;
2059
2060Here, C<< (?>[^()]+) >> breaks the degeneracy of string partitioning
2061by gobbling up as much of the string as possible and keeping it. Then
2062match failures fail much more quickly.
2063
2064=head2 Conditional expressions
2065
2066A S<B<conditional expression> > is a form of if-then-else statement
2067that allows one to choose which patterns are to be matched, based on
2068some condition. There are two types of conditional expression:
2069C<(?(condition)yes-regexp)> and
2070C<(?(condition)yes-regexp|no-regexp)>. C<(?(condition)yes-regexp)> is
2071like an S<C<'if () {}'> > statement in Perl. If the C<condition> is true,
2072the C<yes-regexp> will be matched. If the C<condition> is false, the
2073C<yes-regexp> will be skipped and perl will move onto the next regexp
2074element. The second form is like an S<C<'if () {} else {}'> > statement
2075in Perl. If the C<condition> is true, the C<yes-regexp> will be
2076matched, otherwise the C<no-regexp> will be matched.
2077
2078The C<condition> can have two forms. The first form is simply an
2079integer in parentheses C<(integer)>. It is true if the corresponding
2080backreference C<\integer> matched earlier in the regexp. The second
2081form is a bare zero width assertion C<(?...)>, either a
2082lookahead, a lookbehind, or a code assertion (discussed in the next
2083section).
2084
2085The integer form of the C<condition> allows us to choose, with more
2086flexibility, what to match based on what matched earlier in the
2087regexp. This searches for words of the form C<"$x$x"> or
2088C<"$x$y$y$x">:
2089
2090 % simple_grep '^(\w+)(\w+)?(?(2)\2\1|\1)$' /usr/dict/words
2091 beriberi
2092 coco
2093 couscous
2094 deed
2095 ...
2096 toot
2097 toto
2098 tutu
2099
2100The lookbehind C<condition> allows, along with backreferences,
2101an earlier part of the match to influence a later part of the
2102match. For instance,
2103
2104 /[ATGC]+(?(?<=AA)G|C)$/;
2105
2106matches a DNA sequence such that it either ends in C<AAG>, or some
2107other base pair combination and C<C>. Note that the form is
a6b2f353 2108C<< (?(?<=AA)G|C) >> and not C<< (?((?<=AA))G|C) >>; for the
2109lookahead, lookbehind or code assertions, the parentheses around the
2110conditional are not needed.
47f9c88b 2111
2112=head2 A bit of magic: executing Perl code in a regular expression
2113
2114Normally, regexps are a part of Perl expressions.
2115S<B<Code evaluation> > expressions turn that around by allowing
2116arbitrary Perl code to be a part of of a regexp. A code evaluation
2117expression is denoted C<(?{code})>, with C<code> a string of Perl
2118statements.
2119
2120Code expressions are zero-width assertions, and the value they return
2121depends on their environment. There are two possibilities: either the
2122code expression is used as a conditional in a conditional expression
2123C<(?(condition)...)>, or it is not. If the code expression is a
2124conditional, the code is evaluated and the result (i.e., the result of
2125the last statement) is used to determine truth or falsehood. If the
2126code expression is not used as a conditional, the assertion always
2127evaluates true and the result is put into the special variable
2128C<$^R>. The variable C<$^R> can then be used in code expressions later
2129in the regexp. Here are some silly examples:
2130
2131 $x = "abcdef";
2132 $x =~ /abc(?{print "Hi Mom!";})def/; # matches,
2133 # prints 'Hi Mom!'
2134 $x =~ /aaa(?{print "Hi Mom!";})def/; # doesn't match,
2135 # no 'Hi Mom!'
745e1e41 2136
2137Pay careful attention to the next example:
2138
47f9c88b 2139 $x =~ /abc(?{print "Hi Mom!";})ddd/; # doesn't match,
2140 # no 'Hi Mom!'
745e1e41 2141 # but why not?
2142
2143At first glance, you'd think that it shouldn't print, because obviously
2144the C<ddd> isn't going to match the target string. But look at this
2145example:
2146
2147 $x =~ /abc(?{print "Hi Mom!";})[d]dd/; # doesn't match,
2148 # but _does_ print
2149
2150Hmm. What happened here? If you've been following along, you know that
2151the above pattern should be effectively the same as the last one --
2152enclosing the d in a character class isn't going to change what it
2153matches. So why does the first not print while the second one does?
2154
2155The answer lies in the optimizations the REx engine makes. In the first
2156case, all the engine sees are plain old characters (aside from the
2157C<?{}> construct). It's smart enough to realize that the string 'ddd'
2158doesn't occur in our target string before actually running the pattern
2159through. But in the second case, we've tricked it into thinking that our
2160pattern is more complicated than it is. It takes a look, sees our
2161character class, and decides that it will have to actually run the
2162pattern to determine whether or not it matches, and in the process of
2163running it hits the print statement before it discovers that we don't
2164have a match.
2165
2166To take a closer look at how the engine does optimizations, see the
2167section L<"Pragmas and debugging"> below.
2168
2169More fun with C<?{}>:
2170
47f9c88b 2171 $x =~ /(?{print "Hi Mom!";})/; # matches,
2172 # prints 'Hi Mom!'
2173 $x =~ /(?{$c = 1;})(?{print "$c";})/; # matches,
2174 # prints '1'
2175 $x =~ /(?{$c = 1;})(?{print "$^R";})/; # matches,
2176 # prints '1'
2177
2178The bit of magic mentioned in the section title occurs when the regexp
2179backtracks in the process of searching for a match. If the regexp
2180backtracks over a code expression and if the variables used within are
2181localized using C<local>, the changes in the variables produced by the
2182code expression are undone! Thus, if we wanted to count how many times
2183a character got matched inside a group, we could use, e.g.,
2184
2185 $x = "aaaa";
2186 $count = 0; # initialize 'a' count
2187 $c = "bob"; # test if $c gets clobbered
2188 $x =~ /(?{local $c = 0;}) # initialize count
2189 ( a # match 'a'
2190 (?{local $c = $c + 1;}) # increment count
2191 )* # do this any number of times,
2192 aa # but match 'aa' at the end
2193 (?{$count = $c;}) # copy local $c var into $count
2194 /x;
2195 print "'a' count is $count, \$c variable is '$c'\n";
2196
2197This prints
2198
2199 'a' count is 2, $c variable is 'bob'
2200
2201If we replace the S<C< (?{local $c = $c + 1;})> > with
2202S<C< (?{$c = $c + 1;})> >, the variable changes are I<not> undone
2203during backtracking, and we get
2204
2205 'a' count is 4, $c variable is 'bob'
2206
2207Note that only localized variable changes are undone. Other side
2208effects of code expression execution are permanent. Thus
2209
2210 $x = "aaaa";
2211 $x =~ /(a(?{print "Yow\n";}))*aa/;
2212
2213produces
2214
2215 Yow
2216 Yow
2217 Yow
2218 Yow
2219
2220The result C<$^R> is automatically localized, so that it will behave
2221properly in the presence of backtracking.
2222
2223This example uses a code expression in a conditional to match the
2224article 'the' in either English or German:
2225
47f9c88b 2226 $lang = 'DE'; # use German
2227 ...
2228 $text = "das";
2229 print "matched\n"
2230 if $text =~ /(?(?{
2231 $lang eq 'EN'; # is the language English?
2232 })
2233 the | # if so, then match 'the'
2234 (die|das|der) # else, match 'die|das|der'
2235 )
2236 /xi;
2237
2238Note that the syntax here is C<(?(?{...})yes-regexp|no-regexp)>, not
2239C<(?((?{...}))yes-regexp|no-regexp)>. In other words, in the case of a
2240code expression, we don't need the extra parentheses around the
2241conditional.
2242
a6b2f353 2243If you try to use code expressions with interpolating variables, perl
2244may surprise you:
2245
2246 $bar = 5;
2247 $pat = '(?{ 1 })';
2248 /foo(?{ $bar })bar/; # compiles ok, $bar not interpolated
2249 /foo(?{ 1 })$bar/; # compile error!
2250 /foo${pat}bar/; # compile error!
2251
2252 $pat = qr/(?{ $foo = 1 })/; # precompile code regexp
2253 /foo${pat}bar/; # compiles ok
2254
2255If a regexp has (1) code expressions and interpolating variables,or
2256(2) a variable that interpolates a code expression, perl treats the
2257regexp as an error. If the code expression is precompiled into a
2258variable, however, interpolating is ok. The question is, why is this
2259an error?
2260
2261The reason is that variable interpolation and code expressions
2262together pose a security risk. The combination is dangerous because
2263many programmers who write search engines often take user input and
2264plug it directly into a regexp:
47f9c88b 2265
2266 $regexp = <>; # read user-supplied regexp
2267 $chomp $regexp; # get rid of possible newline
2268 $text =~ /$regexp/; # search $text for the $regexp
2269
a6b2f353 2270If the C<$regexp> variable contains a code expression, the user could
2271then execute arbitrary Perl code. For instance, some joker could
47f9c88b 2272search for S<C<system('rm -rf *');> > to erase your files. In this
2273sense, the combination of interpolation and code expressions B<taints>
2274your regexp. So by default, using both interpolation and code
a6b2f353 2275expressions in the same regexp is not allowed. If you're not
2276concerned about malicious users, it is possible to bypass this
2277security check by invoking S<C<use re 'eval'> >:
2278
2279 use re 'eval'; # throw caution out the door
2280 $bar = 5;
2281 $pat = '(?{ 1 })';
2282 /foo(?{ 1 })$bar/; # compiles ok
2283 /foo${pat}bar/; # compiles ok
47f9c88b 2284
2285Another form of code expression is the S<B<pattern code expression> >.
2286The pattern code expression is like a regular code expression, except
2287that the result of the code evaluation is treated as a regular
2288expression and matched immediately. A simple example is
2289
2290 $length = 5;
2291 $char = 'a';
2292 $x = 'aaaaabb';
2293 $x =~ /(??{$char x $length})/x; # matches, there are 5 of 'a'
2294
2295
2296This final example contains both ordinary and pattern code
2297expressions. It detects if a binary string C<1101010010001...> has a
2298Fibonacci spacing 0,1,1,2,3,5,... of the C<1>'s:
2299
47f9c88b 2300 $s0 = 0; $s1 = 1; # initial conditions
2301 $x = "1101010010001000001";
2302 print "It is a Fibonacci sequence\n"
2303 if $x =~ /^1 # match an initial '1'
2304 (
2305 (??{'0' x $s0}) # match $s0 of '0'
2306 1 # and then a '1'
2307 (?{
2308 $largest = $s0; # largest seq so far
2309 $s2 = $s1 + $s0; # compute next term
2310 $s0 = $s1; # in Fibonacci sequence
2311 $s1 = $s2;
2312 })
2313 )+ # repeat as needed
2314 $ # that is all there is
2315 /x;
2316 print "Largest sequence matched was $largest\n";
2317
2318This prints
2319
2320 It is a Fibonacci sequence
2321 Largest sequence matched was 5
2322
2323Ha! Try that with your garden variety regexp package...
2324
2325Note that the variables C<$s0> and C<$s1> are not substituted when the
2326regexp is compiled, as happens for ordinary variables outside a code
2327expression. Rather, the code expressions are evaluated when perl
2328encounters them during the search for a match.
2329
2330The regexp without the C<//x> modifier is
2331
2332 /^1((??{'0'x$s0})1(?{$largest=$s0;$s2=$s1+$s0$s0=$s1;$s1=$s2;}))+$/;
2333
2334and is a great start on an Obfuscated Perl entry :-) When working with
2335code and conditional expressions, the extended form of regexps is
2336almost necessary in creating and debugging regexps.
2337
2338=head2 Pragmas and debugging
2339
2340Speaking of debugging, there are several pragmas available to control
2341and debug regexps in Perl. We have already encountered one pragma in
2342the previous section, S<C<use re 'eval';> >, that allows variable
a6b2f353 2343interpolation and code expressions to coexist in a regexp. The other
2344pragmas are
47f9c88b 2345
2346 use re 'taint';
2347 $tainted = <>;
2348 @parts = ($tainted =~ /(\w+)\s+(\w+)/; # @parts is now tainted
2349
2350The C<taint> pragma causes any substrings from a match with a tainted
2351variable to be tainted as well. This is not normally the case, as
2352regexps are often used to extract the safe bits from a tainted
2353variable. Use C<taint> when you are not extracting safe bits, but are
2354performing some other processing. Both C<taint> and C<eval> pragmas
a6b2f353 2355are lexically scoped, which means they are in effect only until
47f9c88b 2356the end of the block enclosing the pragmas.
2357
2358 use re 'debug';
2359 /^(.*)$/s; # output debugging info
2360
2361 use re 'debugcolor';
2362 /^(.*)$/s; # output debugging info in living color
2363
2364The global C<debug> and C<debugcolor> pragmas allow one to get
2365detailed debugging info about regexp compilation and
2366execution. C<debugcolor> is the same as debug, except the debugging
2367information is displayed in color on terminals that can display
2368termcap color sequences. Here is example output:
2369
2370 % perl -e 'use re "debug"; "abc" =~ /a*b+c/;'
2371 Compiling REx `a*b+c'
2372 size 9 first at 1
2373 1: STAR(4)
2374 2: EXACT <a>(0)
2375 4: PLUS(7)
2376 5: EXACT <b>(0)
2377 7: EXACT <c>(9)
2378 9: END(0)
2379 floating `bc' at 0..2147483647 (checking floating) minlen 2
2380 Guessing start of match, REx `a*b+c' against `abc'...
2381 Found floating substr `bc' at offset 1...
2382 Guessed: match at offset 0
2383 Matching REx `a*b+c' against `abc'
2384 Setting an EVAL scope, savestack=3
2385 0 <> <abc> | 1: STAR
2386 EXACT <a> can match 1 times out of 32767...
2387 Setting an EVAL scope, savestack=3
2388 1 <a> <bc> | 4: PLUS
2389 EXACT <b> can match 1 times out of 32767...
2390 Setting an EVAL scope, savestack=3
2391 2 <ab> <c> | 7: EXACT <c>
2392 3 <abc> <> | 9: END
2393 Match successful!
2394 Freeing REx: `a*b+c'
2395
2396If you have gotten this far into the tutorial, you can probably guess
2397what the different parts of the debugging output tell you. The first
2398part
2399
2400 Compiling REx `a*b+c'
2401 size 9 first at 1
2402 1: STAR(4)
2403 2: EXACT <a>(0)
2404 4: PLUS(7)
2405 5: EXACT <b>(0)
2406 7: EXACT <c>(9)
2407 9: END(0)
2408
2409describes the compilation stage. C<STAR(4)> means that there is a
2410starred object, in this case C<'a'>, and if it matches, goto line 4,
2411i.e., C<PLUS(7)>. The middle lines describe some heuristics and
2412optimizations performed before a match:
2413
2414 floating `bc' at 0..2147483647 (checking floating) minlen 2
2415 Guessing start of match, REx `a*b+c' against `abc'...
2416 Found floating substr `bc' at offset 1...
2417 Guessed: match at offset 0
2418
2419Then the match is executed and the remaining lines describe the
2420process:
2421
2422 Matching REx `a*b+c' against `abc'
2423 Setting an EVAL scope, savestack=3
2424 0 <> <abc> | 1: STAR
2425 EXACT <a> can match 1 times out of 32767...
2426 Setting an EVAL scope, savestack=3
2427 1 <a> <bc> | 4: PLUS
2428 EXACT <b> can match 1 times out of 32767...
2429 Setting an EVAL scope, savestack=3
2430 2 <ab> <c> | 7: EXACT <c>
2431 3 <abc> <> | 9: END
2432 Match successful!
2433 Freeing REx: `a*b+c'
2434
2435Each step is of the form S<C<< n <x> <y> >> >, with C<< <x> >> the
2436part of the string matched and C<< <y> >> the part not yet
2437matched. The S<C<< | 1: STAR >> > says that perl is at line number 1
2438n the compilation list above. See
2439L<perldebguts/"Debugging regular expressions"> for much more detail.
2440
2441An alternative method of debugging regexps is to embed C<print>
2442statements within the regexp. This provides a blow-by-blow account of
2443the backtracking in an alternation:
2444
2445 "that this" =~ m@(?{print "Start at position ", pos, "\n";})
2446 t(?{print "t1\n";})
2447 h(?{print "h1\n";})
2448 i(?{print "i1\n";})
2449 s(?{print "s1\n";})
2450 |
2451 t(?{print "t2\n";})
2452 h(?{print "h2\n";})
2453 a(?{print "a2\n";})
2454 t(?{print "t2\n";})
2455 (?{print "Done at position ", pos, "\n";})
2456 @x;
2457
2458prints
2459
2460 Start at position 0
2461 t1
2462 h1
2463 t2
2464 h2
2465 a2
2466 t2
2467 Done at position 4
2468
2469=head1 BUGS
2470
2471Code expressions, conditional expressions, and independent expressions
2472are B<experimental>. Don't use them in production code. Yet.
2473
2474=head1 SEE ALSO
2475
2476This is just a tutorial. For the full story on perl regular
2477expressions, see the L<perlre> regular expressions reference page.
2478
2479For more information on the matching C<m//> and substitution C<s///>
2480operators, see L<perlop/"Regexp Quote-Like Operators">. For
2481information on the C<split> operation, see L<perlfunc/split>.
2482
2483For an excellent all-around resource on the care and feeding of
2484regular expressions, see the book I<Mastering Regular Expressions> by
2485Jeffrey Friedl (published by O'Reilly, ISBN 1556592-257-3).
2486
2487=head1 AUTHOR AND COPYRIGHT
2488
2489Copyright (c) 2000 Mark Kvale
2490All rights reserved.
2491
2492This document may be distributed under the same terms as Perl itself.
2493
2494=head2 Acknowledgments
2495
2496The inspiration for the stop codon DNA example came from the ZIP
2497code example in chapter 7 of I<Mastering Regular Expressions>.
2498
a6b2f353 2499The author would like to thank Jeff Pinyan, Andrew Johnson, Peter
2500Haworth, Ronald J Kimball, and Joe Smith for all their helpful
2501comments.
47f9c88b 2502
2503=cut
a6b2f353 2504