OS X: could not -Doptimize=-g.
[p5sagit/p5-mst-13.2.git] / pod / perlretut.pod
CommitLineData
47f9c88b 1=head1 NAME
2
3perlretut - Perl regular expressions tutorial
4
5=head1 DESCRIPTION
6
7This page provides a basic tutorial on understanding, creating and
8using regular expressions in Perl. It serves as a complement to the
9reference page on regular expressions L<perlre>. Regular expressions
10are an integral part of the C<m//>, C<s///>, C<qr//> and C<split>
11operators and so this tutorial also overlaps with
12L<perlop/"Regexp Quote-Like Operators"> and L<perlfunc/split>.
13
14Perl is widely renowned for excellence in text processing, and regular
15expressions are one of the big factors behind this fame. Perl regular
16expressions display an efficiency and flexibility unknown in most
17other computer languages. Mastering even the basics of regular
18expressions will allow you to manipulate text with surprising ease.
19
20What is a regular expression? A regular expression is simply a string
21that describes a pattern. Patterns are in common use these days;
22examples are the patterns typed into a search engine to find web pages
23and the patterns used to list files in a directory, e.g., C<ls *.txt>
24or C<dir *.*>. In Perl, the patterns described by regular expressions
25are used to search strings, extract desired parts of strings, and to
26do search and replace operations.
27
28Regular expressions have the undeserved reputation of being abstract
29and difficult to understand. Regular expressions are constructed using
30simple concepts like conditionals and loops and are no more difficult
31to understand than the corresponding C<if> conditionals and C<while>
32loops in the Perl language itself. In fact, the main challenge in
33learning regular expressions is just getting used to the terse
34notation used to express these concepts.
35
36This tutorial flattens the learning curve by discussing regular
37expression concepts, along with their notation, one at a time and with
38many examples. The first part of the tutorial will progress from the
39simplest word searches to the basic regular expression concepts. If
40you master the first part, you will have all the tools needed to solve
41about 98% of your needs. The second part of the tutorial is for those
42comfortable with the basics and hungry for more power tools. It
43discusses the more advanced regular expression operators and
44introduces the latest cutting edge innovations in 5.6.0.
45
46A note: to save time, 'regular expression' is often abbreviated as
47regexp or regex. Regexp is a more natural abbreviation than regex, but
48is harder to pronounce. The Perl pod documentation is evenly split on
49regexp vs regex; in Perl, there is more than one way to abbreviate it.
50We'll use regexp in this tutorial.
51
52=head1 Part 1: The basics
53
54=head2 Simple word matching
55
56The simplest regexp is simply a word, or more generally, a string of
57characters. A regexp consisting of a word matches any string that
58contains that word:
59
60 "Hello World" =~ /World/; # matches
61
62What is this perl statement all about? C<"Hello World"> is a simple
63double quoted string. C<World> is the regular expression and the
64C<//> enclosing C</World/> tells perl to search a string for a match.
65The operator C<=~> associates the string with the regexp match and
66produces a true value if the regexp matched, or false if the regexp
67did not match. In our case, C<World> matches the second word in
68C<"Hello World">, so the expression is true. Expressions like this
69are useful in conditionals:
70
71 if ("Hello World" =~ /World/) {
72 print "It matches\n";
73 }
74 else {
75 print "It doesn't match\n";
76 }
77
78There are useful variations on this theme. The sense of the match can
79be reversed by using C<!~> operator:
80
81 if ("Hello World" !~ /World/) {
82 print "It doesn't match\n";
83 }
84 else {
85 print "It matches\n";
86 }
87
88The literal string in the regexp can be replaced by a variable:
89
90 $greeting = "World";
91 if ("Hello World" =~ /$greeting/) {
92 print "It matches\n";
93 }
94 else {
95 print "It doesn't match\n";
96 }
97
98If you're matching against the special default variable C<$_>, the
99C<$_ =~> part can be omitted:
100
101 $_ = "Hello World";
102 if (/World/) {
103 print "It matches\n";
104 }
105 else {
106 print "It doesn't match\n";
107 }
108
109And finally, the C<//> default delimiters for a match can be changed
110to arbitrary delimiters by putting an C<'m'> out front:
111
112 "Hello World" =~ m!World!; # matches, delimited by '!'
113 "Hello World" =~ m{World}; # matches, note the matching '{}'
a6b2f353 114 "/usr/bin/perl" =~ m"/perl"; # matches after '/usr/bin',
115 # '/' becomes an ordinary char
47f9c88b 116
117C</World/>, C<m!World!>, and C<m{World}> all represent the
118same thing. When, e.g., C<""> is used as a delimiter, the forward
119slash C<'/'> becomes an ordinary character and can be used in a regexp
120without trouble.
121
122Let's consider how different regexps would match C<"Hello World">:
123
124 "Hello World" =~ /world/; # doesn't match
125 "Hello World" =~ /o W/; # matches
126 "Hello World" =~ /oW/; # doesn't match
127 "Hello World" =~ /World /; # doesn't match
128
129The first regexp C<world> doesn't match because regexps are
130case-sensitive. The second regexp matches because the substring
131S<C<'o W'> > occurs in the string S<C<"Hello World"> >. The space
132character ' ' is treated like any other character in a regexp and is
133needed to match in this case. The lack of a space character is the
134reason the third regexp C<'oW'> doesn't match. The fourth regexp
135C<'World '> doesn't match because there is a space at the end of the
136regexp, but not at the end of the string. The lesson here is that
137regexps must match a part of the string I<exactly> in order for the
138statement to be true.
139
140If a regexp matches in more than one place in the string, perl will
141always match at the earliest possible point in the string:
142
143 "Hello World" =~ /o/; # matches 'o' in 'Hello'
144 "That hat is red" =~ /hat/; # matches 'hat' in 'That'
145
146With respect to character matching, there are a few more points you
147need to know about. First of all, not all characters can be used 'as
148is' in a match. Some characters, called B<metacharacters>, are reserved
149for use in regexp notation. The metacharacters are
150
151 {}[]()^$.|*+?\
152
153The significance of each of these will be explained
154in the rest of the tutorial, but for now, it is important only to know
155that a metacharacter can be matched by putting a backslash before it:
156
157 "2+2=4" =~ /2+2/; # doesn't match, + is a metacharacter
158 "2+2=4" =~ /2\+2/; # matches, \+ is treated like an ordinary +
159 "The interval is [0,1)." =~ /[0,1)./ # is a syntax error!
160 "The interval is [0,1)." =~ /\[0,1\)\./ # matches
161 "/usr/bin/perl" =~ /\/usr\/local\/bin\/perl/; # matches
162
163In the last regexp, the forward slash C<'/'> is also backslashed,
164because it is used to delimit the regexp. This can lead to LTS
165(leaning toothpick syndrome), however, and it is often more readable
166to change delimiters.
167
168
169The backslash character C<'\'> is a metacharacter itself and needs to
170be backslashed:
171
172 'C:\WIN32' =~ /C:\\WIN/; # matches
173
174In addition to the metacharacters, there are some ASCII characters
175which don't have printable character equivalents and are instead
176represented by B<escape sequences>. Common examples are C<\t> for a
177tab, C<\n> for a newline, C<\r> for a carriage return and C<\a> for a
178bell. If your string is better thought of as a sequence of arbitrary
179bytes, the octal escape sequence, e.g., C<\033>, or hexadecimal escape
180sequence, e.g., C<\x1B> may be a more natural representation for your
181bytes. Here are some examples of escapes:
182
183 "1000\t2000" =~ m(0\t2) # matches
184 "1000\n2000" =~ /0\n20/ # matches
185 "1000\t2000" =~ /\000\t2/ # doesn't match, "0" ne "\000"
186 "cat" =~ /\143\x61\x74/ # matches, but a weird way to spell cat
187
188If you've been around Perl a while, all this talk of escape sequences
189may seem familiar. Similar escape sequences are used in double-quoted
190strings and in fact the regexps in Perl are mostly treated as
191double-quoted strings. This means that variables can be used in
192regexps as well. Just like double-quoted strings, the values of the
193variables in the regexp will be substituted in before the regexp is
194evaluated for matching purposes. So we have:
195
196 $foo = 'house';
197 'housecat' =~ /$foo/; # matches
198 'cathouse' =~ /cat$foo/; # matches
47f9c88b 199 'housecat' =~ /${foo}cat/; # matches
200
201So far, so good. With the knowledge above you can already perform
202searches with just about any literal string regexp you can dream up.
203Here is a I<very simple> emulation of the Unix grep program:
204
205 % cat > simple_grep
206 #!/usr/bin/perl
207 $regexp = shift;
208 while (<>) {
209 print if /$regexp/;
210 }
211 ^D
212
213 % chmod +x simple_grep
214
215 % simple_grep abba /usr/dict/words
216 Babbage
217 cabbage
218 cabbages
219 sabbath
220 Sabbathize
221 Sabbathizes
222 sabbatical
223 scabbard
224 scabbards
225
226This program is easy to understand. C<#!/usr/bin/perl> is the standard
227way to invoke a perl program from the shell.
228S<C<$regexp = shift;> > saves the first command line argument as the
229regexp to be used, leaving the rest of the command line arguments to
230be treated as files. S<C<< while (<>) >> > loops over all the lines in
231all the files. For each line, S<C<print if /$regexp/;> > prints the
232line if the regexp matches the line. In this line, both C<print> and
233C</$regexp/> use the default variable C<$_> implicitly.
234
235With all of the regexps above, if the regexp matched anywhere in the
236string, it was considered a match. Sometimes, however, we'd like to
237specify I<where> in the string the regexp should try to match. To do
238this, we would use the B<anchor> metacharacters C<^> and C<$>. The
239anchor C<^> means match at the beginning of the string and the anchor
240C<$> means match at the end of the string, or before a newline at the
241end of the string. Here is how they are used:
242
243 "housekeeper" =~ /keeper/; # matches
244 "housekeeper" =~ /^keeper/; # doesn't match
245 "housekeeper" =~ /keeper$/; # matches
246 "housekeeper\n" =~ /keeper$/; # matches
247
248The second regexp doesn't match because C<^> constrains C<keeper> to
249match only at the beginning of the string, but C<"housekeeper"> has
250keeper starting in the middle. The third regexp does match, since the
251C<$> constrains C<keeper> to match only at the end of the string.
252
253When both C<^> and C<$> are used at the same time, the regexp has to
254match both the beginning and the end of the string, i.e., the regexp
255matches the whole string. Consider
256
257 "keeper" =~ /^keep$/; # doesn't match
258 "keeper" =~ /^keeper$/; # matches
259 "" =~ /^$/; # ^$ matches an empty string
260
261The first regexp doesn't match because the string has more to it than
262C<keep>. Since the second regexp is exactly the string, it
263matches. Using both C<^> and C<$> in a regexp forces the complete
264string to match, so it gives you complete control over which strings
265match and which don't. Suppose you are looking for a fellow named
266bert, off in a string by himself:
267
268 "dogbert" =~ /bert/; # matches, but not what you want
269
270 "dilbert" =~ /^bert/; # doesn't match, but ..
271 "bertram" =~ /^bert/; # matches, so still not good enough
272
273 "bertram" =~ /^bert$/; # doesn't match, good
274 "dilbert" =~ /^bert$/; # doesn't match, good
275 "bert" =~ /^bert$/; # matches, perfect
276
277Of course, in the case of a literal string, one could just as easily
278use the string equivalence S<C<$string eq 'bert'> > and it would be
279more efficient. The C<^...$> regexp really becomes useful when we
280add in the more powerful regexp tools below.
281
282=head2 Using character classes
283
284Although one can already do quite a lot with the literal string
285regexps above, we've only scratched the surface of regular expression
286technology. In this and subsequent sections we will introduce regexp
287concepts (and associated metacharacter notations) that will allow a
288regexp to not just represent a single character sequence, but a I<whole
289class> of them.
290
291One such concept is that of a B<character class>. A character class
292allows a set of possible characters, rather than just a single
293character, to match at a particular point in a regexp. Character
294classes are denoted by brackets C<[...]>, with the set of characters
295to be possibly matched inside. Here are some examples:
296
297 /cat/; # matches 'cat'
298 /[bcr]at/; # matches 'bat, 'cat', or 'rat'
299 /item[0123456789]/; # matches 'item0' or ... or 'item9'
a6b2f353 300 "abc" =~ /[cab]/; # matches 'a'
47f9c88b 301
302In the last statement, even though C<'c'> is the first character in
303the class, C<'a'> matches because the first character position in the
304string is the earliest point at which the regexp can match.
305
306 /[yY][eE][sS]/; # match 'yes' in a case-insensitive way
307 # 'yes', 'Yes', 'YES', etc.
308
da75cd15 309This regexp displays a common task: perform a case-insensitive
47f9c88b 310match. Perl provides away of avoiding all those brackets by simply
311appending an C<'i'> to the end of the match. Then C</[yY][eE][sS]/;>
312can be rewritten as C</yes/i;>. The C<'i'> stands for
313case-insensitive and is an example of a B<modifier> of the matching
314operation. We will meet other modifiers later in the tutorial.
315
316We saw in the section above that there were ordinary characters, which
317represented themselves, and special characters, which needed a
318backslash C<\> to represent themselves. The same is true in a
319character class, but the sets of ordinary and special characters
320inside a character class are different than those outside a character
321class. The special characters for a character class are C<-]\^$>. C<]>
322is special because it denotes the end of a character class. C<$> is
323special because it denotes a scalar variable. C<\> is special because
324it is used in escape sequences, just like above. Here is how the
325special characters C<]$\> are handled:
326
327 /[\]c]def/; # matches ']def' or 'cdef'
328 $x = 'bcr';
a6b2f353 329 /[$x]at/; # matches 'bat', 'cat', or 'rat'
47f9c88b 330 /[\$x]at/; # matches '$at' or 'xat'
331 /[\\$x]at/; # matches '\at', 'bat, 'cat', or 'rat'
332
333The last two are a little tricky. in C<[\$x]>, the backslash protects
334the dollar sign, so the character class has two members C<$> and C<x>.
335In C<[\\$x]>, the backslash is protected, so C<$x> is treated as a
336variable and substituted in double quote fashion.
337
338The special character C<'-'> acts as a range operator within character
339classes, so that a contiguous set of characters can be written as a
340range. With ranges, the unwieldy C<[0123456789]> and C<[abc...xyz]>
341become the svelte C<[0-9]> and C<[a-z]>. Some examples are
342
343 /item[0-9]/; # matches 'item0' or ... or 'item9'
344 /[0-9bx-z]aa/; # matches '0aa', ..., '9aa',
345 # 'baa', 'xaa', 'yaa', or 'zaa'
346 /[0-9a-fA-F]/; # matches a hexadecimal digit
36bbe248 347 /[0-9a-zA-Z_]/; # matches a "word" character,
47f9c88b 348 # like those in a perl variable name
349
350If C<'-'> is the first or last character in a character class, it is
351treated as an ordinary character; C<[-ab]>, C<[ab-]> and C<[a\-b]> are
352all equivalent.
353
354The special character C<^> in the first position of a character class
355denotes a B<negated character class>, which matches any character but
a6b2f353 356those in the brackets. Both C<[...]> and C<[^...]> must match a
47f9c88b 357character, or the match fails. Then
358
359 /[^a]at/; # doesn't match 'aat' or 'at', but matches
360 # all other 'bat', 'cat, '0at', '%at', etc.
361 /[^0-9]/; # matches a non-numeric character
362 /[a^]at/; # matches 'aat' or '^at'; here '^' is ordinary
363
364Now, even C<[0-9]> can be a bother the write multiple times, so in the
365interest of saving keystrokes and making regexps more readable, Perl
366has several abbreviations for common character classes:
367
368=over 4
369
370=item *
551e1d92 371
47f9c88b 372\d is a digit and represents [0-9]
373
374=item *
551e1d92 375
47f9c88b 376\s is a whitespace character and represents [\ \t\r\n\f]
377
378=item *
551e1d92 379
47f9c88b 380\w is a word character (alphanumeric or _) and represents [0-9a-zA-Z_]
381
382=item *
551e1d92 383
47f9c88b 384\D is a negated \d; it represents any character but a digit [^0-9]
385
386=item *
551e1d92 387
47f9c88b 388\S is a negated \s; it represents any non-whitespace character [^\s]
389
390=item *
551e1d92 391
47f9c88b 392\W is a negated \w; it represents any non-word character [^\w]
393
394=item *
551e1d92 395
47f9c88b 396The period '.' matches any character but "\n"
397
398=back
399
400The C<\d\s\w\D\S\W> abbreviations can be used both inside and outside
401of character classes. Here are some in use:
402
403 /\d\d:\d\d:\d\d/; # matches a hh:mm:ss time format
404 /[\d\s]/; # matches any digit or whitespace character
405 /\w\W\w/; # matches a word char, followed by a
406 # non-word char, followed by a word char
407 /..rt/; # matches any two chars, followed by 'rt'
408 /end\./; # matches 'end.'
409 /end[.]/; # same thing, matches 'end.'
410
411Because a period is a metacharacter, it needs to be escaped to match
412as an ordinary period. Because, for example, C<\d> and C<\w> are sets
413of characters, it is incorrect to think of C<[^\d\w]> as C<[\D\W]>; in
414fact C<[^\d\w]> is the same as C<[^\w]>, which is the same as
415C<[\W]>. Think DeMorgan's laws.
416
417An anchor useful in basic regexps is the S<B<word anchor> >
418C<\b>. This matches a boundary between a word character and a non-word
419character C<\w\W> or C<\W\w>:
420
421 $x = "Housecat catenates house and cat";
422 $x =~ /cat/; # matches cat in 'housecat'
423 $x =~ /\bcat/; # matches cat in 'catenates'
424 $x =~ /cat\b/; # matches cat in 'housecat'
425 $x =~ /\bcat\b/; # matches 'cat' at end of string
426
427Note in the last example, the end of the string is considered a word
428boundary.
429
430You might wonder why C<'.'> matches everything but C<"\n"> - why not
431every character? The reason is that often one is matching against
432lines and would like to ignore the newline characters. For instance,
433while the string C<"\n"> represents one line, we would like to think
434of as empty. Then
435
436 "" =~ /^$/; # matches
437 "\n" =~ /^$/; # matches, "\n" is ignored
438
439 "" =~ /./; # doesn't match; it needs a char
440 "" =~ /^.$/; # doesn't match; it needs a char
441 "\n" =~ /^.$/; # doesn't match; it needs a char other than "\n"
442 "a" =~ /^.$/; # matches
443 "a\n" =~ /^.$/; # matches, ignores the "\n"
444
445This behavior is convenient, because we usually want to ignore
446newlines when we count and match characters in a line. Sometimes,
447however, we want to keep track of newlines. We might even want C<^>
448and C<$> to anchor at the beginning and end of lines within the
449string, rather than just the beginning and end of the string. Perl
450allows us to choose between ignoring and paying attention to newlines
451by using the C<//s> and C<//m> modifiers. C<//s> and C<//m> stand for
452single line and multi-line and they determine whether a string is to
453be treated as one continuous string, or as a set of lines. The two
454modifiers affect two aspects of how the regexp is interpreted: 1) how
455the C<'.'> character class is defined, and 2) where the anchors C<^>
456and C<$> are able to match. Here are the four possible combinations:
457
458=over 4
459
460=item *
551e1d92 461
47f9c88b 462no modifiers (//): Default behavior. C<'.'> matches any character
463except C<"\n">. C<^> matches only at the beginning of the string and
464C<$> matches only at the end or before a newline at the end.
465
466=item *
551e1d92 467
47f9c88b 468s modifier (//s): Treat string as a single long line. C<'.'> matches
469any character, even C<"\n">. C<^> matches only at the beginning of
470the string and C<$> matches only at the end or before a newline at the
471end.
472
473=item *
551e1d92 474
47f9c88b 475m modifier (//m): Treat string as a set of multiple lines. C<'.'>
476matches any character except C<"\n">. C<^> and C<$> are able to match
477at the start or end of I<any> line within the string.
478
479=item *
551e1d92 480
47f9c88b 481both s and m modifiers (//sm): Treat string as a single long line, but
482detect multiple lines. C<'.'> matches any character, even
483C<"\n">. C<^> and C<$>, however, are able to match at the start or end
484of I<any> line within the string.
485
486=back
487
488Here are examples of C<//s> and C<//m> in action:
489
490 $x = "There once was a girl\nWho programmed in Perl\n";
491
492 $x =~ /^Who/; # doesn't match, "Who" not at start of string
493 $x =~ /^Who/s; # doesn't match, "Who" not at start of string
494 $x =~ /^Who/m; # matches, "Who" at start of second line
495 $x =~ /^Who/sm; # matches, "Who" at start of second line
496
497 $x =~ /girl.Who/; # doesn't match, "." doesn't match "\n"
498 $x =~ /girl.Who/s; # matches, "." matches "\n"
499 $x =~ /girl.Who/m; # doesn't match, "." doesn't match "\n"
500 $x =~ /girl.Who/sm; # matches, "." matches "\n"
501
502Most of the time, the default behavior is what is want, but C<//s> and
503C<//m> are occasionally very useful. If C<//m> is being used, the start
504of the string can still be matched with C<\A> and the end of string
505can still be matched with the anchors C<\Z> (matches both the end and
506the newline before, like C<$>), and C<\z> (matches only the end):
507
508 $x =~ /^Who/m; # matches, "Who" at start of second line
509 $x =~ /\AWho/m; # doesn't match, "Who" is not at start of string
510
511 $x =~ /girl$/m; # matches, "girl" at end of first line
512 $x =~ /girl\Z/m; # doesn't match, "girl" is not at end of string
513
514 $x =~ /Perl\Z/m; # matches, "Perl" is at newline before end
515 $x =~ /Perl\z/m; # doesn't match, "Perl" is not at end of string
516
517We now know how to create choices among classes of characters in a
518regexp. What about choices among words or character strings? Such
519choices are described in the next section.
520
521=head2 Matching this or that
522
523Sometimes we would like to our regexp to be able to match different
524possible words or character strings. This is accomplished by using
525the B<alternation> metacharacter C<|>. To match C<dog> or C<cat>, we
526form the regexp C<dog|cat>. As before, perl will try to match the
527regexp at the earliest possible point in the string. At each
528character position, perl will first try to match the first
529alternative, C<dog>. If C<dog> doesn't match, perl will then try the
530next alternative, C<cat>. If C<cat> doesn't match either, then the
531match fails and perl moves to the next position in the string. Some
532examples:
533
534 "cats and dogs" =~ /cat|dog|bird/; # matches "cat"
535 "cats and dogs" =~ /dog|cat|bird/; # matches "cat"
536
537Even though C<dog> is the first alternative in the second regexp,
538C<cat> is able to match earlier in the string.
539
540 "cats" =~ /c|ca|cat|cats/; # matches "c"
541 "cats" =~ /cats|cat|ca|c/; # matches "cats"
542
543Here, all the alternatives match at the first string position, so the
544first alternative is the one that matches. If some of the
545alternatives are truncations of the others, put the longest ones first
546to give them a chance to match.
547
548 "cab" =~ /a|b|c/ # matches "c"
549 # /a|b|c/ == /[abc]/
550
551The last example points out that character classes are like
552alternations of characters. At a given character position, the first
210b36aa 553alternative that allows the regexp match to succeed will be the one
47f9c88b 554that matches.
555
556=head2 Grouping things and hierarchical matching
557
558Alternation allows a regexp to choose among alternatives, but by
559itself it unsatisfying. The reason is that each alternative is a whole
560regexp, but sometime we want alternatives for just part of a
561regexp. For instance, suppose we want to search for housecats or
562housekeepers. The regexp C<housecat|housekeeper> fits the bill, but is
563inefficient because we had to type C<house> twice. It would be nice to
da75cd15 564have parts of the regexp be constant, like C<house>, and some
47f9c88b 565parts have alternatives, like C<cat|keeper>.
566
567The B<grouping> metacharacters C<()> solve this problem. Grouping
568allows parts of a regexp to be treated as a single unit. Parts of a
569regexp are grouped by enclosing them in parentheses. Thus we could solve
570the C<housecat|housekeeper> by forming the regexp as
571C<house(cat|keeper)>. The regexp C<house(cat|keeper)> means match
572C<house> followed by either C<cat> or C<keeper>. Some more examples
573are
574
575 /(a|b)b/; # matches 'ab' or 'bb'
576 /(ac|b)b/; # matches 'acb' or 'bb'
577 /(^a|b)c/; # matches 'ac' at start of string or 'bc' anywhere
578 /(a|[bc])d/; # matches 'ad', 'bd', or 'cd'
579
580 /house(cat|)/; # matches either 'housecat' or 'house'
581 /house(cat(s|)|)/; # matches either 'housecats' or 'housecat' or
582 # 'house'. Note groups can be nested.
583
584 /(19|20|)\d\d/; # match years 19xx, 20xx, or the Y2K problem, xx
585 "20" =~ /(19|20|)\d\d/; # matches the null alternative '()\d\d',
586 # because '20\d\d' can't match
587
588Alternations behave the same way in groups as out of them: at a given
589string position, the leftmost alternative that allows the regexp to
210b36aa 590match is taken. So in the last example at the first string position,
47f9c88b 591C<"20"> matches the second alternative, but there is nothing left over
592to match the next two digits C<\d\d>. So perl moves on to the next
593alternative, which is the null alternative and that works, since
594C<"20"> is two digits.
595
596The process of trying one alternative, seeing if it matches, and
597moving on to the next alternative if it doesn't, is called
598B<backtracking>. The term 'backtracking' comes from the idea that
599matching a regexp is like a walk in the woods. Successfully matching
600a regexp is like arriving at a destination. There are many possible
601trailheads, one for each string position, and each one is tried in
602order, left to right. From each trailhead there may be many paths,
603some of which get you there, and some which are dead ends. When you
604walk along a trail and hit a dead end, you have to backtrack along the
605trail to an earlier point to try another trail. If you hit your
606destination, you stop immediately and forget about trying all the
607other trails. You are persistent, and only if you have tried all the
608trails from all the trailheads and not arrived at your destination, do
609you declare failure. To be concrete, here is a step-by-step analysis
610of what perl does when it tries to match the regexp
611
612 "abcde" =~ /(abd|abc)(df|d|de)/;
613
614=over 4
615
551e1d92 616=item 0
617
618Start with the first letter in the string 'a'.
619
620=item 1
47f9c88b 621
551e1d92 622Try the first alternative in the first group 'abd'.
47f9c88b 623
551e1d92 624=item 2
47f9c88b 625
551e1d92 626Match 'a' followed by 'b'. So far so good.
627
628=item 3
629
630'd' in the regexp doesn't match 'c' in the string - a dead
47f9c88b 631end. So backtrack two characters and pick the second alternative in
632the first group 'abc'.
633
551e1d92 634=item 4
635
636Match 'a' followed by 'b' followed by 'c'. We are on a roll
47f9c88b 637and have satisfied the first group. Set $1 to 'abc'.
638
551e1d92 639=item 5
640
641Move on to the second group and pick the first alternative
47f9c88b 642'df'.
643
551e1d92 644=item 6
47f9c88b 645
551e1d92 646Match the 'd'.
647
648=item 7
649
650'f' in the regexp doesn't match 'e' in the string, so a dead
47f9c88b 651end. Backtrack one character and pick the second alternative in the
652second group 'd'.
653
551e1d92 654=item 8
655
656'd' matches. The second grouping is satisfied, so set $2 to
47f9c88b 657'd'.
658
551e1d92 659=item 9
660
661We are at the end of the regexp, so we are done! We have
47f9c88b 662matched 'abcd' out of the string "abcde".
663
664=back
665
666There are a couple of things to note about this analysis. First, the
667third alternative in the second group 'de' also allows a match, but we
668stopped before we got to it - at a given character position, leftmost
669wins. Second, we were able to get a match at the first character
670position of the string 'a'. If there were no matches at the first
671position, perl would move to the second character position 'b' and
672attempt the match all over again. Only when all possible paths at all
da75cd15 673possible character positions have been exhausted does perl give
47f9c88b 674up and declare S<C<$string =~ /(abd|abc)(df|d|de)/;> > to be false.
675
676Even with all this work, regexp matching happens remarkably fast. To
677speed things up, during compilation stage, perl compiles the regexp
678into a compact sequence of opcodes that can often fit inside a
679processor cache. When the code is executed, these opcodes can then run
680at full throttle and search very quickly.
681
682=head2 Extracting matches
683
684The grouping metacharacters C<()> also serve another completely
685different function: they allow the extraction of the parts of a string
686that matched. This is very useful to find out what matched and for
687text processing in general. For each grouping, the part that matched
688inside goes into the special variables C<$1>, C<$2>, etc. They can be
689used just as ordinary variables:
690
691 # extract hours, minutes, seconds
692 $time =~ /(\d\d):(\d\d):(\d\d)/; # match hh:mm:ss format
693 $hours = $1;
694 $minutes = $2;
695 $seconds = $3;
696
697Now, we know that in scalar context,
698S<C<$time =~ /(\d\d):(\d\d):(\d\d)/> > returns a true or false
699value. In list context, however, it returns the list of matched values
700C<($1,$2,$3)>. So we could write the code more compactly as
701
702 # extract hours, minutes, seconds
703 ($hours, $minutes, $second) = ($time =~ /(\d\d):(\d\d):(\d\d)/);
704
705If the groupings in a regexp are nested, C<$1> gets the group with the
706leftmost opening parenthesis, C<$2> the next opening parenthesis,
707etc. For example, here is a complex regexp and the matching variables
708indicated below it:
709
710 /(ab(cd|ef)((gi)|j))/;
711 1 2 34
712
a01268b5 713so that if the regexp matched, e.g., C<$2> would contain 'cd' or 'ef'. For
714convenience, perl sets C<$+> to the string held by the highest numbered
715C<$1>, C<$2>, ... that got assigned (and, somewhat related, C<$^N> to the
716value of the C<$1>, C<$2>, ... most-recently assigned; i.e. the C<$1>,
717C<$2>, ... associated with the rightmost closing parenthesis used in the
718match).
47f9c88b 719
720Closely associated with the matching variables C<$1>, C<$2>, ... are
721the B<backreferences> C<\1>, C<\2>, ... . Backreferences are simply
722matching variables that can be used I<inside> a regexp. This is a
723really nice feature - what matches later in a regexp can depend on
724what matched earlier in the regexp. Suppose we wanted to look
725for doubled words in text, like 'the the'. The following regexp finds
726all 3-letter doubles with a space in between:
727
728 /(\w\w\w)\s\1/;
729
730The grouping assigns a value to \1, so that the same 3 letter sequence
731is used for both parts. Here are some words with repeated parts:
732
733 % simple_grep '^(\w\w\w\w|\w\w\w|\w\w|\w)\1$' /usr/dict/words
734 beriberi
735 booboo
736 coco
737 mama
738 murmur
739 papa
740
741The regexp has a single grouping which considers 4-letter
742combinations, then 3-letter combinations, etc. and uses C<\1> to look for
743a repeat. Although C<$1> and C<\1> represent the same thing, care should be
744taken to use matched variables C<$1>, C<$2>, ... only outside a regexp
745and backreferences C<\1>, C<\2>, ... only inside a regexp; not doing
746so may lead to surprising and/or undefined results.
747
748In addition to what was matched, Perl 5.6.0 also provides the
749positions of what was matched with the C<@-> and C<@+>
750arrays. C<$-[0]> is the position of the start of the entire match and
751C<$+[0]> is the position of the end. Similarly, C<$-[n]> is the
752position of the start of the C<$n> match and C<$+[n]> is the position
753of the end. If C<$n> is undefined, so are C<$-[n]> and C<$+[n]>. Then
754this code
755
756 $x = "Mmm...donut, thought Homer";
757 $x =~ /^(Mmm|Yech)\.\.\.(donut|peas)/; # matches
758 foreach $expr (1..$#-) {
759 print "Match $expr: '${$expr}' at position ($-[$expr],$+[$expr])\n";
760 }
761
762prints
763
764 Match 1: 'Mmm' at position (0,3)
765 Match 2: 'donut' at position (6,11)
766
767Even if there are no groupings in a regexp, it is still possible to
768find out what exactly matched in a string. If you use them, perl
769will set C<$`> to the part of the string before the match, will set C<$&>
770to the part of the string that matched, and will set C<$'> to the part
771of the string after the match. An example:
772
773 $x = "the cat caught the mouse";
774 $x =~ /cat/; # $` = 'the ', $& = 'cat', $' = ' caught the mouse'
775 $x =~ /the/; # $` = '', $& = 'the', $' = ' cat caught the mouse'
776
777In the second match, S<C<$` = ''> > because the regexp matched at the
778first character position in the string and stopped, it never saw the
779second 'the'. It is important to note that using C<$`> and C<$'>
a6b2f353 780slows down regexp matching quite a bit, and C< $& > slows it down to a
47f9c88b 781lesser extent, because if they are used in one regexp in a program,
782they are generated for <all> regexps in the program. So if raw
783performance is a goal of your application, they should be avoided.
784If you need them, use C<@-> and C<@+> instead:
785
786 $` is the same as substr( $x, 0, $-[0] )
787 $& is the same as substr( $x, $-[0], $+[0]-$-[0] )
788 $' is the same as substr( $x, $+[0] )
789
790=head2 Matching repetitions
791
792The examples in the previous section display an annoying weakness. We
793were only matching 3-letter words, or syllables of 4 letters or
794less. We'd like to be able to match words or syllables of any length,
795without writing out tedious alternatives like
796C<\w\w\w\w|\w\w\w|\w\w|\w>.
797
798This is exactly the problem the B<quantifier> metacharacters C<?>,
799C<*>, C<+>, and C<{}> were created for. They allow us to determine the
800number of repeats of a portion of a regexp we consider to be a
801match. Quantifiers are put immediately after the character, character
802class, or grouping that we want to specify. They have the following
803meanings:
804
805=over 4
806
551e1d92 807=item *
47f9c88b 808
551e1d92 809C<a?> = match 'a' 1 or 0 times
47f9c88b 810
551e1d92 811=item *
812
813C<a*> = match 'a' 0 or more times, i.e., any number of times
814
815=item *
47f9c88b 816
551e1d92 817C<a+> = match 'a' 1 or more times, i.e., at least once
818
819=item *
820
821C<a{n,m}> = match at least C<n> times, but not more than C<m>
47f9c88b 822times.
823
551e1d92 824=item *
825
826C<a{n,}> = match at least C<n> or more times
827
828=item *
47f9c88b 829
551e1d92 830C<a{n}> = match exactly C<n> times
47f9c88b 831
832=back
833
834Here are some examples:
835
836 /[a-z]+\s+\d*/; # match a lowercase word, at least some space, and
837 # any number of digits
838 /(\w+)\s+\1/; # match doubled words of arbitrary length
839 /y(es)?/i; # matches 'y', 'Y', or a case-insensitive 'yes'
840 $year =~ /\d{2,4}/; # make sure year is at least 2 but not more
841 # than 4 digits
842 $year =~ /\d{4}|\d{2}/; # better match; throw out 3 digit dates
843 $year =~ /\d{2}(\d{2})?/; # same thing written differently. However,
844 # this produces $1 and the other does not.
845
846 % simple_grep '^(\w+)\1$' /usr/dict/words # isn't this easier?
847 beriberi
848 booboo
849 coco
850 mama
851 murmur
852 papa
853
854For all of these quantifiers, perl will try to match as much of the
855string as possible, while still allowing the regexp to succeed. Thus
856with C</a?.../>, perl will first try to match the regexp with the C<a>
857present; if that fails, perl will try to match the regexp without the
858C<a> present. For the quantifier C<*>, we get the following:
859
860 $x = "the cat in the hat";
861 $x =~ /^(.*)(cat)(.*)$/; # matches,
862 # $1 = 'the '
863 # $2 = 'cat'
864 # $3 = ' in the hat'
865
866Which is what we might expect, the match finds the only C<cat> in the
867string and locks onto it. Consider, however, this regexp:
868
869 $x =~ /^(.*)(at)(.*)$/; # matches,
870 # $1 = 'the cat in the h'
871 # $2 = 'at'
872 # $3 = '' (0 matches)
873
874One might initially guess that perl would find the C<at> in C<cat> and
875stop there, but that wouldn't give the longest possible string to the
876first quantifier C<.*>. Instead, the first quantifier C<.*> grabs as
877much of the string as possible while still having the regexp match. In
a6b2f353 878this example, that means having the C<at> sequence with the final C<at>
47f9c88b 879in the string. The other important principle illustrated here is that
880when there are two or more elements in a regexp, the I<leftmost>
881quantifier, if there is one, gets to grab as much the string as
882possible, leaving the rest of the regexp to fight over scraps. Thus in
883our example, the first quantifier C<.*> grabs most of the string, while
884the second quantifier C<.*> gets the empty string. Quantifiers that
885grab as much of the string as possible are called B<maximal match> or
886B<greedy> quantifiers.
887
888When a regexp can match a string in several different ways, we can use
889the principles above to predict which way the regexp will match:
890
891=over 4
892
893=item *
551e1d92 894
47f9c88b 895Principle 0: Taken as a whole, any regexp will be matched at the
896earliest possible position in the string.
897
898=item *
551e1d92 899
47f9c88b 900Principle 1: In an alternation C<a|b|c...>, the leftmost alternative
901that allows a match for the whole regexp will be the one used.
902
903=item *
551e1d92 904
47f9c88b 905Principle 2: The maximal matching quantifiers C<?>, C<*>, C<+> and
906C<{n,m}> will in general match as much of the string as possible while
907still allowing the whole regexp to match.
908
909=item *
551e1d92 910
47f9c88b 911Principle 3: If there are two or more elements in a regexp, the
912leftmost greedy quantifier, if any, will match as much of the string
913as possible while still allowing the whole regexp to match. The next
914leftmost greedy quantifier, if any, will try to match as much of the
915string remaining available to it as possible, while still allowing the
916whole regexp to match. And so on, until all the regexp elements are
917satisfied.
918
919=back
920
921As we have seen above, Principle 0 overrides the others - the regexp
922will be matched as early as possible, with the other principles
923determining how the regexp matches at that earliest character
924position.
925
926Here is an example of these principles in action:
927
928 $x = "The programming republic of Perl";
929 $x =~ /^(.+)(e|r)(.*)$/; # matches,
930 # $1 = 'The programming republic of Pe'
931 # $2 = 'r'
932 # $3 = 'l'
933
934This regexp matches at the earliest string position, C<'T'>. One
935might think that C<e>, being leftmost in the alternation, would be
936matched, but C<r> produces the longest string in the first quantifier.
937
938 $x =~ /(m{1,2})(.*)$/; # matches,
939 # $1 = 'mm'
940 # $2 = 'ing republic of Perl'
941
942Here, The earliest possible match is at the first C<'m'> in
943C<programming>. C<m{1,2}> is the first quantifier, so it gets to match
944a maximal C<mm>.
945
946 $x =~ /.*(m{1,2})(.*)$/; # matches,
947 # $1 = 'm'
948 # $2 = 'ing republic of Perl'
949
950Here, the regexp matches at the start of the string. The first
951quantifier C<.*> grabs as much as possible, leaving just a single
952C<'m'> for the second quantifier C<m{1,2}>.
953
954 $x =~ /(.?)(m{1,2})(.*)$/; # matches,
955 # $1 = 'a'
956 # $2 = 'mm'
957 # $3 = 'ing republic of Perl'
958
959Here, C<.?> eats its maximal one character at the earliest possible
960position in the string, C<'a'> in C<programming>, leaving C<m{1,2}>
961the opportunity to match both C<m>'s. Finally,
962
963 "aXXXb" =~ /(X*)/; # matches with $1 = ''
964
965because it can match zero copies of C<'X'> at the beginning of the
966string. If you definitely want to match at least one C<'X'>, use
967C<X+>, not C<X*>.
968
969Sometimes greed is not good. At times, we would like quantifiers to
970match a I<minimal> piece of string, rather than a maximal piece. For
971this purpose, Larry Wall created the S<B<minimal match> > or
972B<non-greedy> quantifiers C<??>,C<*?>, C<+?>, and C<{}?>. These are
973the usual quantifiers with a C<?> appended to them. They have the
974following meanings:
975
976=over 4
977
551e1d92 978=item *
979
980C<a??> = match 'a' 0 or 1 times. Try 0 first, then 1.
47f9c88b 981
551e1d92 982=item *
983
984C<a*?> = match 'a' 0 or more times, i.e., any number of times,
47f9c88b 985but as few times as possible
986
551e1d92 987=item *
988
989C<a+?> = match 'a' 1 or more times, i.e., at least once, but
47f9c88b 990as few times as possible
991
551e1d92 992=item *
993
994C<a{n,m}?> = match at least C<n> times, not more than C<m>
47f9c88b 995times, as few times as possible
996
551e1d92 997=item *
998
999C<a{n,}?> = match at least C<n> times, but as few times as
47f9c88b 1000possible
1001
551e1d92 1002=item *
1003
1004C<a{n}?> = match exactly C<n> times. Because we match exactly
47f9c88b 1005C<n> times, C<a{n}?> is equivalent to C<a{n}> and is just there for
1006notational consistency.
1007
1008=back
1009
1010Let's look at the example above, but with minimal quantifiers:
1011
1012 $x = "The programming republic of Perl";
1013 $x =~ /^(.+?)(e|r)(.*)$/; # matches,
1014 # $1 = 'Th'
1015 # $2 = 'e'
1016 # $3 = ' programming republic of Perl'
1017
1018The minimal string that will allow both the start of the string C<^>
1019and the alternation to match is C<Th>, with the alternation C<e|r>
1020matching C<e>. The second quantifier C<.*> is free to gobble up the
1021rest of the string.
1022
1023 $x =~ /(m{1,2}?)(.*?)$/; # matches,
1024 # $1 = 'm'
1025 # $2 = 'ming republic of Perl'
1026
1027The first string position that this regexp can match is at the first
1028C<'m'> in C<programming>. At this position, the minimal C<m{1,2}?>
1029matches just one C<'m'>. Although the second quantifier C<.*?> would
1030prefer to match no characters, it is constrained by the end-of-string
1031anchor C<$> to match the rest of the string.
1032
1033 $x =~ /(.*?)(m{1,2}?)(.*)$/; # matches,
1034 # $1 = 'The progra'
1035 # $2 = 'm'
1036 # $3 = 'ming republic of Perl'
1037
1038In this regexp, you might expect the first minimal quantifier C<.*?>
1039to match the empty string, because it is not constrained by a C<^>
1040anchor to match the beginning of the word. Principle 0 applies here,
1041however. Because it is possible for the whole regexp to match at the
1042start of the string, it I<will> match at the start of the string. Thus
1043the first quantifier has to match everything up to the first C<m>. The
1044second minimal quantifier matches just one C<m> and the third
1045quantifier matches the rest of the string.
1046
1047 $x =~ /(.??)(m{1,2})(.*)$/; # matches,
1048 # $1 = 'a'
1049 # $2 = 'mm'
1050 # $3 = 'ing republic of Perl'
1051
1052Just as in the previous regexp, the first quantifier C<.??> can match
1053earliest at position C<'a'>, so it does. The second quantifier is
1054greedy, so it matches C<mm>, and the third matches the rest of the
1055string.
1056
1057We can modify principle 3 above to take into account non-greedy
1058quantifiers:
1059
1060=over 4
1061
1062=item *
551e1d92 1063
47f9c88b 1064Principle 3: If there are two or more elements in a regexp, the
1065leftmost greedy (non-greedy) quantifier, if any, will match as much
1066(little) of the string as possible while still allowing the whole
1067regexp to match. The next leftmost greedy (non-greedy) quantifier, if
1068any, will try to match as much (little) of the string remaining
1069available to it as possible, while still allowing the whole regexp to
1070match. And so on, until all the regexp elements are satisfied.
1071
1072=back
1073
1074Just like alternation, quantifiers are also susceptible to
1075backtracking. Here is a step-by-step analysis of the example
1076
1077 $x = "the cat in the hat";
1078 $x =~ /^(.*)(at)(.*)$/; # matches,
1079 # $1 = 'the cat in the h'
1080 # $2 = 'at'
1081 # $3 = '' (0 matches)
1082
1083=over 4
1084
551e1d92 1085=item 0
1086
1087Start with the first letter in the string 't'.
47f9c88b 1088
551e1d92 1089=item 1
1090
1091The first quantifier '.*' starts out by matching the whole
47f9c88b 1092string 'the cat in the hat'.
1093
551e1d92 1094=item 2
1095
1096'a' in the regexp element 'at' doesn't match the end of the
47f9c88b 1097string. Backtrack one character.
1098
551e1d92 1099=item 3
1100
1101'a' in the regexp element 'at' still doesn't match the last
47f9c88b 1102letter of the string 't', so backtrack one more character.
1103
551e1d92 1104=item 4
1105
1106Now we can match the 'a' and the 't'.
47f9c88b 1107
551e1d92 1108=item 5
1109
1110Move on to the third element '.*'. Since we are at the end of
47f9c88b 1111the string and '.*' can match 0 times, assign it the empty string.
1112
551e1d92 1113=item 6
1114
1115We are done!
47f9c88b 1116
1117=back
1118
1119Most of the time, all this moving forward and backtracking happens
1120quickly and searching is fast. There are some pathological regexps,
1121however, whose execution time exponentially grows with the size of the
1122string. A typical structure that blows up in your face is of the form
1123
1124 /(a|b+)*/;
1125
1126The problem is the nested indeterminate quantifiers. There are many
1127different ways of partitioning a string of length n between the C<+>
1128and C<*>: one repetition with C<b+> of length n, two repetitions with
1129the first C<b+> length k and the second with length n-k, m repetitions
1130whose bits add up to length n, etc. In fact there are an exponential
1131number of ways to partition a string as a function of length. A
1132regexp may get lucky and match early in the process, but if there is
1133no match, perl will try I<every> possibility before giving up. So be
1134careful with nested C<*>'s, C<{n,m}>'s, and C<+>'s. The book
1135I<Mastering regular expressions> by Jeffrey Friedl gives a wonderful
1136discussion of this and other efficiency issues.
1137
1138=head2 Building a regexp
1139
1140At this point, we have all the basic regexp concepts covered, so let's
1141give a more involved example of a regular expression. We will build a
1142regexp that matches numbers.
1143
1144The first task in building a regexp is to decide what we want to match
1145and what we want to exclude. In our case, we want to match both
1146integers and floating point numbers and we want to reject any string
1147that isn't a number.
1148
1149The next task is to break the problem down into smaller problems that
1150are easily converted into a regexp.
1151
1152The simplest case is integers. These consist of a sequence of digits,
1153with an optional sign in front. The digits we can represent with
1154C<\d+> and the sign can be matched with C<[+-]>. Thus the integer
1155regexp is
1156
1157 /[+-]?\d+/; # matches integers
1158
1159A floating point number potentially has a sign, an integral part, a
1160decimal point, a fractional part, and an exponent. One or more of these
1161parts is optional, so we need to check out the different
1162possibilities. Floating point numbers which are in proper form include
1163123., 0.345, .34, -1e6, and 25.4E-72. As with integers, the sign out
1164front is completely optional and can be matched by C<[+-]?>. We can
1165see that if there is no exponent, floating point numbers must have a
1166decimal point, otherwise they are integers. We might be tempted to
1167model these with C<\d*\.\d*>, but this would also match just a single
1168decimal point, which is not a number. So the three cases of floating
1169point number sans exponent are
1170
1171 /[+-]?\d+\./; # 1., 321., etc.
1172 /[+-]?\.\d+/; # .1, .234, etc.
1173 /[+-]?\d+\.\d+/; # 1.0, 30.56, etc.
1174
1175These can be combined into a single regexp with a three-way alternation:
1176
1177 /[+-]?(\d+\.\d+|\d+\.|\.\d+)/; # floating point, no exponent
1178
1179In this alternation, it is important to put C<'\d+\.\d+'> before
1180C<'\d+\.'>. If C<'\d+\.'> were first, the regexp would happily match that
1181and ignore the fractional part of the number.
1182
1183Now consider floating point numbers with exponents. The key
1184observation here is that I<both> integers and numbers with decimal
1185points are allowed in front of an exponent. Then exponents, like the
1186overall sign, are independent of whether we are matching numbers with
1187or without decimal points, and can be 'decoupled' from the
1188mantissa. The overall form of the regexp now becomes clear:
1189
1190 /^(optional sign)(integer | f.p. mantissa)(optional exponent)$/;
1191
1192The exponent is an C<e> or C<E>, followed by an integer. So the
1193exponent regexp is
1194
1195 /[eE][+-]?\d+/; # exponent
1196
1197Putting all the parts together, we get a regexp that matches numbers:
1198
1199 /^[+-]?(\d+\.\d+|\d+\.|\.\d+|\d+)([eE][+-]?\d+)?$/; # Ta da!
1200
1201Long regexps like this may impress your friends, but can be hard to
1202decipher. In complex situations like this, the C<//x> modifier for a
1203match is invaluable. It allows one to put nearly arbitrary whitespace
1204and comments into a regexp without affecting their meaning. Using it,
1205we can rewrite our 'extended' regexp in the more pleasing form
1206
1207 /^
1208 [+-]? # first, match an optional sign
1209 ( # then match integers or f.p. mantissas:
1210 \d+\.\d+ # mantissa of the form a.b
1211 |\d+\. # mantissa of the form a.
1212 |\.\d+ # mantissa of the form .b
1213 |\d+ # integer of the form a
1214 )
1215 ([eE][+-]?\d+)? # finally, optionally match an exponent
1216 $/x;
1217
1218If whitespace is mostly irrelevant, how does one include space
1219characters in an extended regexp? The answer is to backslash it
1220S<C<'\ '> > or put it in a character class S<C<[ ]> >. The same thing
1221goes for pound signs, use C<\#> or C<[#]>. For instance, Perl allows
1222a space between the sign and the mantissa/integer, and we could add
1223this to our regexp as follows:
1224
1225 /^
1226 [+-]?\ * # first, match an optional sign *and space*
1227 ( # then match integers or f.p. mantissas:
1228 \d+\.\d+ # mantissa of the form a.b
1229 |\d+\. # mantissa of the form a.
1230 |\.\d+ # mantissa of the form .b
1231 |\d+ # integer of the form a
1232 )
1233 ([eE][+-]?\d+)? # finally, optionally match an exponent
1234 $/x;
1235
1236In this form, it is easier to see a way to simplify the
1237alternation. Alternatives 1, 2, and 4 all start with C<\d+>, so it
1238could be factored out:
1239
1240 /^
1241 [+-]?\ * # first, match an optional sign
1242 ( # then match integers or f.p. mantissas:
1243 \d+ # start out with a ...
1244 (
1245 \.\d* # mantissa of the form a.b or a.
1246 )? # ? takes care of integers of the form a
1247 |\.\d+ # mantissa of the form .b
1248 )
1249 ([eE][+-]?\d+)? # finally, optionally match an exponent
1250 $/x;
1251
1252or written in the compact form,
1253
1254 /^[+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?$/;
1255
1256This is our final regexp. To recap, we built a regexp by
1257
1258=over 4
1259
551e1d92 1260=item *
1261
1262specifying the task in detail,
47f9c88b 1263
551e1d92 1264=item *
1265
1266breaking down the problem into smaller parts,
1267
1268=item *
47f9c88b 1269
551e1d92 1270translating the small parts into regexps,
47f9c88b 1271
551e1d92 1272=item *
1273
1274combining the regexps,
1275
1276=item *
47f9c88b 1277
551e1d92 1278and optimizing the final combined regexp.
47f9c88b 1279
1280=back
1281
1282These are also the typical steps involved in writing a computer
1283program. This makes perfect sense, because regular expressions are
1284essentially programs written a little computer language that specifies
1285patterns.
1286
1287=head2 Using regular expressions in Perl
1288
1289The last topic of Part 1 briefly covers how regexps are used in Perl
1290programs. Where do they fit into Perl syntax?
1291
1292We have already introduced the matching operator in its default
1293C</regexp/> and arbitrary delimiter C<m!regexp!> forms. We have used
1294the binding operator C<=~> and its negation C<!~> to test for string
1295matches. Associated with the matching operator, we have discussed the
1296single line C<//s>, multi-line C<//m>, case-insensitive C<//i> and
1297extended C<//x> modifiers.
1298
1299There are a few more things you might want to know about matching
1300operators. First, we pointed out earlier that variables in regexps are
1301substituted before the regexp is evaluated:
1302
1303 $pattern = 'Seuss';
1304 while (<>) {
1305 print if /$pattern/;
1306 }
1307
1308This will print any lines containing the word C<Seuss>. It is not as
1309efficient as it could be, however, because perl has to re-evaluate
1310C<$pattern> each time through the loop. If C<$pattern> won't be
1311changing over the lifetime of the script, we can add the C<//o>
1312modifier, which directs perl to only perform variable substitutions
1313once:
1314
1315 #!/usr/bin/perl
1316 # Improved simple_grep
1317 $regexp = shift;
1318 while (<>) {
1319 print if /$regexp/o; # a good deal faster
1320 }
1321
1322If you change C<$pattern> after the first substitution happens, perl
1323will ignore it. If you don't want any substitutions at all, use the
1324special delimiter C<m''>:
1325
1326 $pattern = 'Seuss';
1327 while (<>) {
1328 print if m'$pattern'; # matches '$pattern', not 'Seuss'
1329 }
1330
1331C<m''> acts like single quotes on a regexp; all other C<m> delimiters
1332act like double quotes. If the regexp evaluates to the empty string,
1333the regexp in the I<last successful match> is used instead. So we have
1334
1335 "dog" =~ /d/; # 'd' matches
1336 "dogbert =~ //; # this matches the 'd' regexp used before
1337
1338The final two modifiers C<//g> and C<//c> concern multiple matches.
da75cd15 1339The modifier C<//g> stands for global matching and allows the
47f9c88b 1340matching operator to match within a string as many times as possible.
1341In scalar context, successive invocations against a string will have
1342`C<//g> jump from match to match, keeping track of position in the
1343string as it goes along. You can get or set the position with the
1344C<pos()> function.
1345
1346The use of C<//g> is shown in the following example. Suppose we have
1347a string that consists of words separated by spaces. If we know how
1348many words there are in advance, we could extract the words using
1349groupings:
1350
1351 $x = "cat dog house"; # 3 words
1352 $x =~ /^\s*(\w+)\s+(\w+)\s+(\w+)\s*$/; # matches,
1353 # $1 = 'cat'
1354 # $2 = 'dog'
1355 # $3 = 'house'
1356
1357But what if we had an indeterminate number of words? This is the sort
1358of task C<//g> was made for. To extract all words, form the simple
1359regexp C<(\w+)> and loop over all matches with C</(\w+)/g>:
1360
1361 while ($x =~ /(\w+)/g) {
1362 print "Word is $1, ends at position ", pos $x, "\n";
1363 }
1364
1365prints
1366
1367 Word is cat, ends at position 3
1368 Word is dog, ends at position 7
1369 Word is house, ends at position 13
1370
1371A failed match or changing the target string resets the position. If
1372you don't want the position reset after failure to match, add the
1373C<//c>, as in C</regexp/gc>. The current position in the string is
1374associated with the string, not the regexp. This means that different
1375strings have different positions and their respective positions can be
1376set or read independently.
1377
1378In list context, C<//g> returns a list of matched groupings, or if
1379there are no groupings, a list of matches to the whole regexp. So if
1380we wanted just the words, we could use
1381
1382 @words = ($x =~ /(\w+)/g); # matches,
1383 # $word[0] = 'cat'
1384 # $word[1] = 'dog'
1385 # $word[2] = 'house'
1386
1387Closely associated with the C<//g> modifier is the C<\G> anchor. The
1388C<\G> anchor matches at the point where the previous C<//g> match left
1389off. C<\G> allows us to easily do context-sensitive matching:
1390
1391 $metric = 1; # use metric units
1392 ...
1393 $x = <FILE>; # read in measurement
1394 $x =~ /^([+-]?\d+)\s*/g; # get magnitude
1395 $weight = $1;
1396 if ($metric) { # error checking
1397 print "Units error!" unless $x =~ /\Gkg\./g;
1398 }
1399 else {
1400 print "Units error!" unless $x =~ /\Glbs\./g;
1401 }
1402 $x =~ /\G\s+(widget|sprocket)/g; # continue processing
1403
1404The combination of C<//g> and C<\G> allows us to process the string a
1405bit at a time and use arbitrary Perl logic to decide what to do next.
25cf8c22 1406Currently, the C<\G> anchor is only fully supported when used to anchor
1407to the start of the pattern.
47f9c88b 1408
1409C<\G> is also invaluable in processing fixed length records with
1410regexps. Suppose we have a snippet of coding region DNA, encoded as
1411base pair letters C<ATCGTTGAAT...> and we want to find all the stop
1412codons C<TGA>. In a coding region, codons are 3-letter sequences, so
1413we can think of the DNA snippet as a sequence of 3-letter records. The
1414naive regexp
1415
1416 # expanded, this is "ATC GTT GAA TGC AAA TGA CAT GAC"
1417 $dna = "ATCGTTGAATGCAAATGACATGAC";
1418 $dna =~ /TGA/;
1419
d1be9408 1420doesn't work; it may match a C<TGA>, but there is no guarantee that
47f9c88b 1421the match is aligned with codon boundaries, e.g., the substring
1422S<C<GTT GAA> > gives a match. A better solution is
1423
1424 while ($dna =~ /(\w\w\w)*?TGA/g) { # note the minimal *?
1425 print "Got a TGA stop codon at position ", pos $dna, "\n";
1426 }
1427
1428which prints
1429
1430 Got a TGA stop codon at position 18
1431 Got a TGA stop codon at position 23
1432
1433Position 18 is good, but position 23 is bogus. What happened?
1434
1435The answer is that our regexp works well until we get past the last
1436real match. Then the regexp will fail to match a synchronized C<TGA>
1437and start stepping ahead one character position at a time, not what we
1438want. The solution is to use C<\G> to anchor the match to the codon
1439alignment:
1440
1441 while ($dna =~ /\G(\w\w\w)*?TGA/g) {
1442 print "Got a TGA stop codon at position ", pos $dna, "\n";
1443 }
1444
1445This prints
1446
1447 Got a TGA stop codon at position 18
1448
1449which is the correct answer. This example illustrates that it is
1450important not only to match what is desired, but to reject what is not
1451desired.
1452
1453B<search and replace>
1454
1455Regular expressions also play a big role in B<search and replace>
1456operations in Perl. Search and replace is accomplished with the
1457C<s///> operator. The general form is
1458C<s/regexp/replacement/modifiers>, with everything we know about
1459regexps and modifiers applying in this case as well. The
1460C<replacement> is a Perl double quoted string that replaces in the
1461string whatever is matched with the C<regexp>. The operator C<=~> is
1462also used here to associate a string with C<s///>. If matching
1463against C<$_>, the S<C<$_ =~> > can be dropped. If there is a match,
1464C<s///> returns the number of substitutions made, otherwise it returns
1465false. Here are a few examples:
1466
1467 $x = "Time to feed the cat!";
1468 $x =~ s/cat/hacker/; # $x contains "Time to feed the hacker!"
1469 if ($x =~ s/^(Time.*hacker)!$/$1 now!/) {
1470 $more_insistent = 1;
1471 }
1472 $y = "'quoted words'";
1473 $y =~ s/^'(.*)'$/$1/; # strip single quotes,
1474 # $y contains "quoted words"
1475
1476In the last example, the whole string was matched, but only the part
1477inside the single quotes was grouped. With the C<s///> operator, the
1478matched variables C<$1>, C<$2>, etc. are immediately available for use
1479in the replacement expression, so we use C<$1> to replace the quoted
1480string with just what was quoted. With the global modifier, C<s///g>
1481will search and replace all occurrences of the regexp in the string:
1482
1483 $x = "I batted 4 for 4";
1484 $x =~ s/4/four/; # doesn't do it all:
1485 # $x contains "I batted four for 4"
1486 $x = "I batted 4 for 4";
1487 $x =~ s/4/four/g; # does it all:
1488 # $x contains "I batted four for four"
1489
1490If you prefer 'regex' over 'regexp' in this tutorial, you could use
1491the following program to replace it:
1492
1493 % cat > simple_replace
1494 #!/usr/bin/perl
1495 $regexp = shift;
1496 $replacement = shift;
1497 while (<>) {
1498 s/$regexp/$replacement/go;
1499 print;
1500 }
1501 ^D
1502
1503 % simple_replace regexp regex perlretut.pod
1504
1505In C<simple_replace> we used the C<s///g> modifier to replace all
1506occurrences of the regexp on each line and the C<s///o> modifier to
1507compile the regexp only once. As with C<simple_grep>, both the
1508C<print> and the C<s/$regexp/$replacement/go> use C<$_> implicitly.
1509
1510A modifier available specifically to search and replace is the
1511C<s///e> evaluation modifier. C<s///e> wraps an C<eval{...}> around
1512the replacement string and the evaluated result is substituted for the
1513matched substring. C<s///e> is useful if you need to do a bit of
1514computation in the process of replacing text. This example counts
1515character frequencies in a line:
1516
1517 $x = "Bill the cat";
1518 $x =~ s/(.)/$chars{$1}++;$1/eg; # final $1 replaces char with itself
1519 print "frequency of '$_' is $chars{$_}\n"
1520 foreach (sort {$chars{$b} <=> $chars{$a}} keys %chars);
1521
1522This prints
1523
1524 frequency of ' ' is 2
1525 frequency of 't' is 2
1526 frequency of 'l' is 2
1527 frequency of 'B' is 1
1528 frequency of 'c' is 1
1529 frequency of 'e' is 1
1530 frequency of 'h' is 1
1531 frequency of 'i' is 1
1532 frequency of 'a' is 1
1533
1534As with the match C<m//> operator, C<s///> can use other delimiters,
1535such as C<s!!!> and C<s{}{}>, and even C<s{}//>. If single quotes are
1536used C<s'''>, then the regexp and replacement are treated as single
1537quoted strings and there are no substitutions. C<s///> in list context
1538returns the same thing as in scalar context, i.e., the number of
1539matches.
1540
1541B<The split operator>
1542
1543The B<C<split> > function can also optionally use a matching operator
1544C<m//> to split a string. C<split /regexp/, string, limit> splits
1545C<string> into a list of substrings and returns that list. The regexp
1546is used to match the character sequence that the C<string> is split
1547with respect to. The C<limit>, if present, constrains splitting into
1548no more than C<limit> number of strings. For example, to split a
1549string into words, use
1550
1551 $x = "Calvin and Hobbes";
1552 @words = split /\s+/, $x; # $word[0] = 'Calvin'
1553 # $word[1] = 'and'
1554 # $word[2] = 'Hobbes'
1555
1556If the empty regexp C<//> is used, the regexp always matches and
1557the string is split into individual characters. If the regexp has
1558groupings, then list produced contains the matched substrings from the
1559groupings as well. For instance,
1560
1561 $x = "/usr/bin/perl";
1562 @dirs = split m!/!, $x; # $dirs[0] = ''
1563 # $dirs[1] = 'usr'
1564 # $dirs[2] = 'bin'
1565 # $dirs[3] = 'perl'
1566 @parts = split m!(/)!, $x; # $parts[0] = ''
1567 # $parts[1] = '/'
1568 # $parts[2] = 'usr'
1569 # $parts[3] = '/'
1570 # $parts[4] = 'bin'
1571 # $parts[5] = '/'
1572 # $parts[6] = 'perl'
1573
1574Since the first character of $x matched the regexp, C<split> prepended
1575an empty initial element to the list.
1576
1577If you have read this far, congratulations! You now have all the basic
1578tools needed to use regular expressions to solve a wide range of text
1579processing problems. If this is your first time through the tutorial,
1580why not stop here and play around with regexps a while... S<Part 2>
1581concerns the more esoteric aspects of regular expressions and those
1582concepts certainly aren't needed right at the start.
1583
1584=head1 Part 2: Power tools
1585
1586OK, you know the basics of regexps and you want to know more. If
1587matching regular expressions is analogous to a walk in the woods, then
1588the tools discussed in Part 1 are analogous to topo maps and a
1589compass, basic tools we use all the time. Most of the tools in part 2
da75cd15 1590are analogous to flare guns and satellite phones. They aren't used
47f9c88b 1591too often on a hike, but when we are stuck, they can be invaluable.
1592
1593What follows are the more advanced, less used, or sometimes esoteric
1594capabilities of perl regexps. In Part 2, we will assume you are
1595comfortable with the basics and concentrate on the new features.
1596
1597=head2 More on characters, strings, and character classes
1598
1599There are a number of escape sequences and character classes that we
1600haven't covered yet.
1601
1602There are several escape sequences that convert characters or strings
1603between upper and lower case. C<\l> and C<\u> convert the next
1604character to lower or upper case, respectively:
1605
1606 $x = "perl";
1607 $string =~ /\u$x/; # matches 'Perl' in $string
1608 $x = "M(rs?|s)\\."; # note the double backslash
1609 $string =~ /\l$x/; # matches 'mr.', 'mrs.', and 'ms.',
1610
1611C<\L> and C<\U> converts a whole substring, delimited by C<\L> or
1612C<\U> and C<\E>, to lower or upper case:
1613
1614 $x = "This word is in lower case:\L SHOUT\E";
1615 $x =~ /shout/; # matches
1616 $x = "I STILL KEYPUNCH CARDS FOR MY 360"
1617 $x =~ /\Ukeypunch/; # matches punch card string
1618
1619If there is no C<\E>, case is converted until the end of the
1620string. The regexps C<\L\u$word> or C<\u\L$word> convert the first
1621character of C<$word> to uppercase and the rest of the characters to
1622lowercase.
1623
1624Control characters can be escaped with C<\c>, so that a control-Z
1625character would be matched with C<\cZ>. The escape sequence
1626C<\Q>...C<\E> quotes, or protects most non-alphabetic characters. For
1627instance,
1628
1629 $x = "\QThat !^*&%~& cat!";
1630 $x =~ /\Q!^*&%~&\E/; # check for rough language
1631
1632It does not protect C<$> or C<@>, so that variables can still be
1633substituted.
1634
1635With the advent of 5.6.0, perl regexps can handle more than just the
1636standard ASCII character set. Perl now supports B<Unicode>, a standard
1637for encoding the character sets from many of the world's written
1638languages. Unicode does this by allowing characters to be more than
1639one byte wide. Perl uses the UTF-8 encoding, in which ASCII characters
1640are still encoded as one byte, but characters greater than C<chr(127)>
1641may be stored as two or more bytes.
1642
1643What does this mean for regexps? Well, regexp users don't need to know
1644much about perl's internal representation of strings. But they do need
1645to know 1) how to represent Unicode characters in a regexp and 2) when
1646a matching operation will treat the string to be searched as a
1647sequence of bytes (the old way) or as a sequence of Unicode characters
1648(the new way). The answer to 1) is that Unicode characters greater
1649than C<chr(127)> may be represented using the C<\x{hex}> notation,
1650with C<hex> a hexadecimal integer:
1651
47f9c88b 1652 /\x{263a}/; # match a Unicode smiley face :)
1653
1654Unicode characters in the range of 128-255 use two hexadecimal digits
1655with braces: C<\x{ab}>. Note that this is different than C<\xab>,
ad0029c4 1656which is just a hexadecimal byte with no Unicode significance.
1657
72ff2908 1658B<NOTE>: in Perl 5.6.0 it used to be that one needed to say C<use
1659utf8> to use any Unicode features. This is no more the case: for
1660almost all Unicode processing, the explicit C<utf8> pragma is not
1661needed. (The only case where it matters is if your Perl script is in
1662Unicode and encoded in UTF-8, then an explicit C<use utf8> is needed.)
47f9c88b 1663
1664Figuring out the hexadecimal sequence of a Unicode character you want
1665or deciphering someone else's hexadecimal Unicode regexp is about as
1666much fun as programming in machine code. So another way to specify
1667Unicode characters is to use the S<B<named character> > escape
1668sequence C<\N{name}>. C<name> is a name for the Unicode character, as
55eda711 1669specified in the Unicode standard. For instance, if we wanted to
1670represent or match the astrological sign for the planet Mercury, we
1671could use
47f9c88b 1672
47f9c88b 1673 use charnames ":full"; # use named chars with Unicode full names
1674 $x = "abc\N{MERCURY}def";
1675 $x =~ /\N{MERCURY}/; # matches
1676
1677One can also use short names or restrict names to a certain alphabet:
1678
47f9c88b 1679 use charnames ':full';
1680 print "\N{GREEK SMALL LETTER SIGMA} is called sigma.\n";
1681
1682 use charnames ":short";
1683 print "\N{greek:Sigma} is an upper-case sigma.\n";
1684
1685 use charnames qw(greek);
1686 print "\N{sigma} is Greek sigma\n";
1687
1688A list of full names is found in the file Names.txt in the
55d7b906 1689lib/perl5/5.X.X/unicore directory.
47f9c88b 1690
1691The answer to requirement 2), as of 5.6.0, is that if a regexp
1692contains Unicode characters, the string is searched as a sequence of
1693Unicode characters. Otherwise, the string is searched as a sequence of
1694bytes. If the string is being searched as a sequence of Unicode
1695characters, but matching a single byte is required, we can use the C<\C>
1696escape sequence. C<\C> is a character class akin to C<.> except that
1697it matches I<any> byte 0-255. So
1698
47f9c88b 1699 use charnames ":full"; # use named chars with Unicode full names
1700 $x = "a";
1701 $x =~ /\C/; # matches 'a', eats one byte
1702 $x = "";
1703 $x =~ /\C/; # doesn't match, no bytes to match
1704 $x = "\N{MERCURY}"; # two-byte Unicode character
1705 $x =~ /\C/; # matches, but dangerous!
1706
1707The last regexp matches, but is dangerous because the string
a6b2f353 1708I<character> position is no longer synchronized to the string I<byte>
47f9c88b 1709position. This generates the warning 'Malformed UTF-8
f14c76ed 1710character'. The C<\C> is best used for matching the binary data in strings
47f9c88b 1711with binary data intermixed with Unicode characters.
1712
1713Let us now discuss the rest of the character classes. Just as with
1714Unicode characters, there are named Unicode character classes
1715represented by the C<\p{name}> escape sequence. Closely associated is
1716the C<\P{name}> character class, which is the negation of the
1717C<\p{name}> class. For example, to match lower and uppercase
1718characters,
1719
47f9c88b 1720 use charnames ":full"; # use named chars with Unicode full names
1721 $x = "BOB";
1722 $x =~ /^\p{IsUpper}/; # matches, uppercase char class
1723 $x =~ /^\P{IsUpper}/; # doesn't match, char class sans uppercase
1724 $x =~ /^\p{IsLower}/; # doesn't match, lowercase char class
1725 $x =~ /^\P{IsLower}/; # matches, char class sans lowercase
1726
86929931 1727Here is the association between some Perl named classes and the
1728traditional Unicode classes:
47f9c88b 1729
86929931 1730 Perl class name Unicode class name or regular expression
47f9c88b 1731
f5868911 1732 IsAlpha /^[LM]/
1733 IsAlnum /^[LMN]/
1734 IsASCII $code <= 127
1735 IsCntrl /^C/
1736 IsBlank $code =~ /^(0020|0009)$/ || /^Z[^lp]/
47f9c88b 1737 IsDigit Nd
f5868911 1738 IsGraph /^([LMNPS]|Co)/
47f9c88b 1739 IsLower Ll
f5868911 1740 IsPrint /^([LMNPS]|Co|Zs)/
1741 IsPunct /^P/
1742 IsSpace /^Z/ || ($code =~ /^(0009|000A|000B|000C|000D)$/
08ce8fc6 1743 IsSpacePerl /^Z/ || ($code =~ /^(0009|000A|000C|000D|0085|2028|2029)$/
f5868911 1744 IsUpper /^L[ut]/
1745 IsWord /^[LMN]/ || $code eq "005F"
47f9c88b 1746 IsXDigit $code =~ /^00(3[0-9]|[46][1-6])$/
1747
86929931 1748You can also use the official Unicode class names with the C<\p> and
1749C<\P>, like C<\p{L}> for Unicode 'letters', or C<\p{Lu}> for uppercase
1750letters, or C<\P{Nd}> for non-digits. If a C<name> is just one
1751letter, the braces can be dropped. For instance, C<\pM> is the
98f22ffc 1752character class of Unicode 'marks', for example accent marks.
32293815 1753For the full list see L<perlunicode>.
1754
5e42d7b4 1755The Unicode has also been separated into various sets of charaters
1756which you can test with C<\p{In...}> (in) and C<\P{In...}> (not in),
1d81abf3 1757for example C<\p{Latin}>, C<\p{Greek}>, or C<\P{Katakana}>.
5e42d7b4 1758For the full list see L<perlunicode>.
47f9c88b 1759
1760C<\X> is an abbreviation for a character class sequence that includes
1761the Unicode 'combining character sequences'. A 'combining character
1762sequence' is a base character followed by any number of combining
1763characters. An example of a combining character is an accent. Using
1764the Unicode full names, e.g., S<C<A + COMBINING RING> > is a combining
1765character sequence with base character C<A> and combining character
1766S<C<COMBINING RING> >, which translates in Danish to A with the circle
1767atop it, as in the word Angstrom. C<\X> is equivalent to C<\PM\pM*}>,
1768i.e., a non-mark followed by one or more marks.
1769
da75cd15 1770For the full and latest information about Unicode see the latest
5e42d7b4 1771Unicode standard, or the Unicode Consortium's website http://www.unicode.org/
1772
47f9c88b 1773As if all those classes weren't enough, Perl also defines POSIX style
1774character classes. These have the form C<[:name:]>, with C<name> the
aaa51d5e 1775name of the POSIX class. The POSIX classes are C<alpha>, C<alnum>,
1776C<ascii>, C<cntrl>, C<digit>, C<graph>, C<lower>, C<print>, C<punct>,
1777C<space>, C<upper>, and C<xdigit>, and two extensions, C<word> (a Perl
1778extension to match C<\w>), and C<blank> (a GNU extension). If C<utf8>
1779is being used, then these classes are defined the same as their
1780corresponding perl Unicode classes: C<[:upper:]> is the same as
1781C<\p{IsUpper}>, etc. The POSIX character classes, however, don't
1782require using C<utf8>. The C<[:digit:]>, C<[:word:]>, and
47f9c88b 1783C<[:space:]> correspond to the familiar C<\d>, C<\w>, and C<\s>
aaa51d5e 1784character classes. To negate a POSIX class, put a C<^> in front of
1785the name, so that, e.g., C<[:^digit:]> corresponds to C<\D> and under
47f9c88b 1786C<utf8>, C<\P{IsDigit}>. The Unicode and POSIX character classes can
54c18d04 1787be used just like C<\d>, with the exception that POSIX character
1788classes can only be used inside of a character class:
47f9c88b 1789
1790 /\s+[abc[:digit:]xyz]\s*/; # match a,b,c,x,y,z, or a digit
54c18d04 1791 /^=item\s[[:digit:]]/; # match '=item',
47f9c88b 1792 # followed by a space and a digit
47f9c88b 1793 use charnames ":full";
1794 /\s+[abc\p{IsDigit}xyz]\s+/; # match a,b,c,x,y,z, or a digit
1795 /^=item\s\p{IsDigit}/; # match '=item',
1796 # followed by a space and a digit
1797
1798Whew! That is all the rest of the characters and character classes.
1799
1800=head2 Compiling and saving regular expressions
1801
1802In Part 1 we discussed the C<//o> modifier, which compiles a regexp
1803just once. This suggests that a compiled regexp is some data structure
1804that can be stored once and used again and again. The regexp quote
1805C<qr//> does exactly that: C<qr/string/> compiles the C<string> as a
1806regexp and transforms the result into a form that can be assigned to a
1807variable:
1808
1809 $reg = qr/foo+bar?/; # reg contains a compiled regexp
1810
1811Then C<$reg> can be used as a regexp:
1812
1813 $x = "fooooba";
1814 $x =~ $reg; # matches, just like /foo+bar?/
1815 $x =~ /$reg/; # same thing, alternate form
1816
1817C<$reg> can also be interpolated into a larger regexp:
1818
1819 $x =~ /(abc)?$reg/; # still matches
1820
1821As with the matching operator, the regexp quote can use different
1822delimiters, e.g., C<qr!!>, C<qr{}> and C<qr~~>. The single quote
1823delimiters C<qr''> prevent any interpolation from taking place.
1824
1825Pre-compiled regexps are useful for creating dynamic matches that
1826don't need to be recompiled each time they are encountered. Using
1827pre-compiled regexps, C<simple_grep> program can be expanded into a
1828program that matches multiple patterns:
1829
1830 % cat > multi_grep
1831 #!/usr/bin/perl
1832 # multi_grep - match any of <number> regexps
1833 # usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ...
1834
1835 $number = shift;
1836 $regexp[$_] = shift foreach (0..$number-1);
1837 @compiled = map qr/$_/, @regexp;
1838 while ($line = <>) {
1839 foreach $pattern (@compiled) {
1840 if ($line =~ /$pattern/) {
1841 print $line;
1842 last; # we matched, so move onto the next line
1843 }
1844 }
1845 }
1846 ^D
1847
1848 % multi_grep 2 last for multi_grep
1849 $regexp[$_] = shift foreach (0..$number-1);
1850 foreach $pattern (@compiled) {
1851 last;
1852
1853Storing pre-compiled regexps in an array C<@compiled> allows us to
1854simply loop through the regexps without any recompilation, thus gaining
1855flexibility without sacrificing speed.
1856
1857=head2 Embedding comments and modifiers in a regular expression
1858
1859Starting with this section, we will be discussing Perl's set of
1860B<extended patterns>. These are extensions to the traditional regular
1861expression syntax that provide powerful new tools for pattern
1862matching. We have already seen extensions in the form of the minimal
1863matching constructs C<??>, C<*?>, C<+?>, C<{n,m}?>, and C<{n,}?>. The
1864rest of the extensions below have the form C<(?char...)>, where the
1865C<char> is a character that determines the type of extension.
1866
1867The first extension is an embedded comment C<(?#text)>. This embeds a
1868comment into the regular expression without affecting its meaning. The
1869comment should not have any closing parentheses in the text. An
1870example is
1871
1872 /(?# Match an integer:)[+-]?\d+/;
1873
1874This style of commenting has been largely superseded by the raw,
1875freeform commenting that is allowed with the C<//x> modifier.
1876
1877The modifiers C<//i>, C<//m>, C<//s>, and C<//x> can also embedded in
1878a regexp using C<(?i)>, C<(?m)>, C<(?s)>, and C<(?x)>. For instance,
1879
1880 /(?i)yes/; # match 'yes' case insensitively
1881 /yes/i; # same thing
1882 /(?x)( # freeform version of an integer regexp
1883 [+-]? # match an optional sign
1884 \d+ # match a sequence of digits
1885 )
1886 /x;
1887
1888Embedded modifiers can have two important advantages over the usual
1889modifiers. Embedded modifiers allow a custom set of modifiers to
1890I<each> regexp pattern. This is great for matching an array of regexps
1891that must have different modifiers:
1892
1893 $pattern[0] = '(?i)doctor';
1894 $pattern[1] = 'Johnson';
1895 ...
1896 while (<>) {
1897 foreach $patt (@pattern) {
1898 print if /$patt/;
1899 }
1900 }
1901
1902The second advantage is that embedded modifiers only affect the regexp
1903inside the group the embedded modifier is contained in. So grouping
1904can be used to localize the modifier's effects:
1905
1906 /Answer: ((?i)yes)/; # matches 'Answer: yes', 'Answer: YES', etc.
1907
1908Embedded modifiers can also turn off any modifiers already present
1909by using, e.g., C<(?-i)>. Modifiers can also be combined into
1910a single expression, e.g., C<(?s-i)> turns on single line mode and
1911turns off case insensitivity.
1912
1913=head2 Non-capturing groupings
1914
1915We noted in Part 1 that groupings C<()> had two distinct functions: 1)
1916group regexp elements together as a single unit, and 2) extract, or
1917capture, substrings that matched the regexp in the
1918grouping. Non-capturing groupings, denoted by C<(?:regexp)>, allow the
1919regexp to be treated as a single unit, but don't extract substrings or
1920set matching variables C<$1>, etc. Both capturing and non-capturing
1921groupings are allowed to co-exist in the same regexp. Because there is
1922no extraction, non-capturing groupings are faster than capturing
1923groupings. Non-capturing groupings are also handy for choosing exactly
1924which parts of a regexp are to be extracted to matching variables:
1925
1926 # match a number, $1-$4 are set, but we only want $1
1927 /([+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?)/;
1928
1929 # match a number faster , only $1 is set
1930 /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE][+-]?\d+)?)/;
1931
1932 # match a number, get $1 = whole number, $2 = exponent
1933 /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE]([+-]?\d+))?)/;
1934
1935Non-capturing groupings are also useful for removing nuisance
1936elements gathered from a split operation:
1937
1938 $x = '12a34b5';
1939 @num = split /(a|b)/, $x; # @num = ('12','a','34','b','5')
1940 @num = split /(?:a|b)/, $x; # @num = ('12','34','5')
1941
1942Non-capturing groupings may also have embedded modifiers:
1943C<(?i-m:regexp)> is a non-capturing grouping that matches C<regexp>
1944case insensitively and turns off multi-line mode.
1945
1946=head2 Looking ahead and looking behind
1947
1948This section concerns the lookahead and lookbehind assertions. First,
1949a little background.
1950
1951In Perl regular expressions, most regexp elements 'eat up' a certain
1952amount of string when they match. For instance, the regexp element
1953C<[abc}]> eats up one character of the string when it matches, in the
1954sense that perl moves to the next character position in the string
1955after the match. There are some elements, however, that don't eat up
1956characters (advance the character position) if they match. The examples
1957we have seen so far are the anchors. The anchor C<^> matches the
1958beginning of the line, but doesn't eat any characters. Similarly, the
1959word boundary anchor C<\b> matches, e.g., if the character to the left
1960is a word character and the character to the right is a non-word
1961character, but it doesn't eat up any characters itself. Anchors are
1962examples of 'zero-width assertions'. Zero-width, because they consume
1963no characters, and assertions, because they test some property of the
1964string. In the context of our walk in the woods analogy to regexp
1965matching, most regexp elements move us along a trail, but anchors have
1966us stop a moment and check our surroundings. If the local environment
1967checks out, we can proceed forward. But if the local environment
1968doesn't satisfy us, we must backtrack.
1969
1970Checking the environment entails either looking ahead on the trail,
1971looking behind, or both. C<^> looks behind, to see that there are no
1972characters before. C<$> looks ahead, to see that there are no
1973characters after. C<\b> looks both ahead and behind, to see if the
1974characters on either side differ in their 'word'-ness.
1975
1976The lookahead and lookbehind assertions are generalizations of the
1977anchor concept. Lookahead and lookbehind are zero-width assertions
1978that let us specify which characters we want to test for. The
1979lookahead assertion is denoted by C<(?=regexp)> and the lookbehind
a6b2f353 1980assertion is denoted by C<< (?<=fixed-regexp) >>. Some examples are
47f9c88b 1981
1982 $x = "I catch the housecat 'Tom-cat' with catnip";
1983 $x =~ /cat(?=\s+)/; # matches 'cat' in 'housecat'
1984 @catwords = ($x =~ /(?<=\s)cat\w+/g); # matches,
1985 # $catwords[0] = 'catch'
1986 # $catwords[1] = 'catnip'
1987 $x =~ /\bcat\b/; # matches 'cat' in 'Tom-cat'
1988 $x =~ /(?<=\s)cat(?=\s)/; # doesn't match; no isolated 'cat' in
1989 # middle of $x
1990
a6b2f353 1991Note that the parentheses in C<(?=regexp)> and C<< (?<=regexp) >> are
47f9c88b 1992non-capturing, since these are zero-width assertions. Thus in the
1993second regexp, the substrings captured are those of the whole regexp
a6b2f353 1994itself. Lookahead C<(?=regexp)> can match arbitrary regexps, but
1995lookbehind C<< (?<=fixed-regexp) >> only works for regexps of fixed
1996width, i.e., a fixed number of characters long. Thus
1997C<< (?<=(ab|bc)) >> is fine, but C<< (?<=(ab)*) >> is not. The
1998negated versions of the lookahead and lookbehind assertions are
1999denoted by C<(?!regexp)> and C<< (?<!fixed-regexp) >> respectively.
2000They evaluate true if the regexps do I<not> match:
47f9c88b 2001
2002 $x = "foobar";
2003 $x =~ /foo(?!bar)/; # doesn't match, 'bar' follows 'foo'
2004 $x =~ /foo(?!baz)/; # matches, 'baz' doesn't follow 'foo'
2005 $x =~ /(?<!\s)foo/; # matches, there is no \s before 'foo'
2006
f14c76ed 2007The C<\C> is unsupported in lookbehind, because the already
2008treacherous definition of C<\C> would become even more so
2009when going backwards.
2010
47f9c88b 2011=head2 Using independent subexpressions to prevent backtracking
2012
2013The last few extended patterns in this tutorial are experimental as of
20145.6.0. Play with them, use them in some code, but don't rely on them
2015just yet for production code.
2016
2017S<B<Independent subexpressions> > are regular expressions, in the
2018context of a larger regular expression, that function independently of
2019the larger regular expression. That is, they consume as much or as
2020little of the string as they wish without regard for the ability of
2021the larger regexp to match. Independent subexpressions are represented
2022by C<< (?>regexp) >>. We can illustrate their behavior by first
2023considering an ordinary regexp:
2024
2025 $x = "ab";
2026 $x =~ /a*ab/; # matches
2027
2028This obviously matches, but in the process of matching, the
2029subexpression C<a*> first grabbed the C<a>. Doing so, however,
2030wouldn't allow the whole regexp to match, so after backtracking, C<a*>
2031eventually gave back the C<a> and matched the empty string. Here, what
2032C<a*> matched was I<dependent> on what the rest of the regexp matched.
2033
2034Contrast that with an independent subexpression:
2035
2036 $x =~ /(?>a*)ab/; # doesn't match!
2037
2038The independent subexpression C<< (?>a*) >> doesn't care about the rest
2039of the regexp, so it sees an C<a> and grabs it. Then the rest of the
2040regexp C<ab> cannot match. Because C<< (?>a*) >> is independent, there
da75cd15 2041is no backtracking and the independent subexpression does not give
47f9c88b 2042up its C<a>. Thus the match of the regexp as a whole fails. A similar
2043behavior occurs with completely independent regexps:
2044
2045 $x = "ab";
2046 $x =~ /a*/g; # matches, eats an 'a'
2047 $x =~ /\Gab/g; # doesn't match, no 'a' available
2048
2049Here C<//g> and C<\G> create a 'tag team' handoff of the string from
2050one regexp to the other. Regexps with an independent subexpression are
2051much like this, with a handoff of the string to the independent
2052subexpression, and a handoff of the string back to the enclosing
2053regexp.
2054
2055The ability of an independent subexpression to prevent backtracking
2056can be quite useful. Suppose we want to match a non-empty string
2057enclosed in parentheses up to two levels deep. Then the following
2058regexp matches:
2059
2060 $x = "abc(de(fg)h"; # unbalanced parentheses
2061 $x =~ /\( ( [^()]+ | \([^()]*\) )+ \)/x;
2062
2063The regexp matches an open parenthesis, one or more copies of an
2064alternation, and a close parenthesis. The alternation is two-way, with
2065the first alternative C<[^()]+> matching a substring with no
2066parentheses and the second alternative C<\([^()]*\)> matching a
2067substring delimited by parentheses. The problem with this regexp is
2068that it is pathological: it has nested indeterminate quantifiers
07698885 2069of the form C<(a+|b)+>. We discussed in Part 1 how nested quantifiers
47f9c88b 2070like this could take an exponentially long time to execute if there
2071was no match possible. To prevent the exponential blowup, we need to
2072prevent useless backtracking at some point. This can be done by
2073enclosing the inner quantifier as an independent subexpression:
2074
2075 $x =~ /\( ( (?>[^()]+) | \([^()]*\) )+ \)/x;
2076
2077Here, C<< (?>[^()]+) >> breaks the degeneracy of string partitioning
2078by gobbling up as much of the string as possible and keeping it. Then
2079match failures fail much more quickly.
2080
2081=head2 Conditional expressions
2082
2083A S<B<conditional expression> > is a form of if-then-else statement
2084that allows one to choose which patterns are to be matched, based on
2085some condition. There are two types of conditional expression:
2086C<(?(condition)yes-regexp)> and
2087C<(?(condition)yes-regexp|no-regexp)>. C<(?(condition)yes-regexp)> is
2088like an S<C<'if () {}'> > statement in Perl. If the C<condition> is true,
2089the C<yes-regexp> will be matched. If the C<condition> is false, the
2090C<yes-regexp> will be skipped and perl will move onto the next regexp
2091element. The second form is like an S<C<'if () {} else {}'> > statement
2092in Perl. If the C<condition> is true, the C<yes-regexp> will be
2093matched, otherwise the C<no-regexp> will be matched.
2094
2095The C<condition> can have two forms. The first form is simply an
2096integer in parentheses C<(integer)>. It is true if the corresponding
2097backreference C<\integer> matched earlier in the regexp. The second
2098form is a bare zero width assertion C<(?...)>, either a
2099lookahead, a lookbehind, or a code assertion (discussed in the next
2100section).
2101
2102The integer form of the C<condition> allows us to choose, with more
2103flexibility, what to match based on what matched earlier in the
2104regexp. This searches for words of the form C<"$x$x"> or
2105C<"$x$y$y$x">:
2106
2107 % simple_grep '^(\w+)(\w+)?(?(2)\2\1|\1)$' /usr/dict/words
2108 beriberi
2109 coco
2110 couscous
2111 deed
2112 ...
2113 toot
2114 toto
2115 tutu
2116
2117The lookbehind C<condition> allows, along with backreferences,
2118an earlier part of the match to influence a later part of the
2119match. For instance,
2120
2121 /[ATGC]+(?(?<=AA)G|C)$/;
2122
2123matches a DNA sequence such that it either ends in C<AAG>, or some
2124other base pair combination and C<C>. Note that the form is
a6b2f353 2125C<< (?(?<=AA)G|C) >> and not C<< (?((?<=AA))G|C) >>; for the
2126lookahead, lookbehind or code assertions, the parentheses around the
2127conditional are not needed.
47f9c88b 2128
2129=head2 A bit of magic: executing Perl code in a regular expression
2130
2131Normally, regexps are a part of Perl expressions.
2132S<B<Code evaluation> > expressions turn that around by allowing
da75cd15 2133arbitrary Perl code to be a part of a regexp. A code evaluation
47f9c88b 2134expression is denoted C<(?{code})>, with C<code> a string of Perl
2135statements.
2136
2137Code expressions are zero-width assertions, and the value they return
2138depends on their environment. There are two possibilities: either the
2139code expression is used as a conditional in a conditional expression
2140C<(?(condition)...)>, or it is not. If the code expression is a
2141conditional, the code is evaluated and the result (i.e., the result of
2142the last statement) is used to determine truth or falsehood. If the
2143code expression is not used as a conditional, the assertion always
2144evaluates true and the result is put into the special variable
2145C<$^R>. The variable C<$^R> can then be used in code expressions later
2146in the regexp. Here are some silly examples:
2147
2148 $x = "abcdef";
2149 $x =~ /abc(?{print "Hi Mom!";})def/; # matches,
2150 # prints 'Hi Mom!'
2151 $x =~ /aaa(?{print "Hi Mom!";})def/; # doesn't match,
2152 # no 'Hi Mom!'
745e1e41 2153
2154Pay careful attention to the next example:
2155
47f9c88b 2156 $x =~ /abc(?{print "Hi Mom!";})ddd/; # doesn't match,
2157 # no 'Hi Mom!'
745e1e41 2158 # but why not?
2159
2160At first glance, you'd think that it shouldn't print, because obviously
2161the C<ddd> isn't going to match the target string. But look at this
2162example:
2163
2164 $x =~ /abc(?{print "Hi Mom!";})[d]dd/; # doesn't match,
2165 # but _does_ print
2166
2167Hmm. What happened here? If you've been following along, you know that
2168the above pattern should be effectively the same as the last one --
2169enclosing the d in a character class isn't going to change what it
2170matches. So why does the first not print while the second one does?
2171
2172The answer lies in the optimizations the REx engine makes. In the first
2173case, all the engine sees are plain old characters (aside from the
2174C<?{}> construct). It's smart enough to realize that the string 'ddd'
2175doesn't occur in our target string before actually running the pattern
2176through. But in the second case, we've tricked it into thinking that our
2177pattern is more complicated than it is. It takes a look, sees our
2178character class, and decides that it will have to actually run the
2179pattern to determine whether or not it matches, and in the process of
2180running it hits the print statement before it discovers that we don't
2181have a match.
2182
2183To take a closer look at how the engine does optimizations, see the
2184section L<"Pragmas and debugging"> below.
2185
2186More fun with C<?{}>:
2187
47f9c88b 2188 $x =~ /(?{print "Hi Mom!";})/; # matches,
2189 # prints 'Hi Mom!'
2190 $x =~ /(?{$c = 1;})(?{print "$c";})/; # matches,
2191 # prints '1'
2192 $x =~ /(?{$c = 1;})(?{print "$^R";})/; # matches,
2193 # prints '1'
2194
2195The bit of magic mentioned in the section title occurs when the regexp
2196backtracks in the process of searching for a match. If the regexp
2197backtracks over a code expression and if the variables used within are
2198localized using C<local>, the changes in the variables produced by the
2199code expression are undone! Thus, if we wanted to count how many times
2200a character got matched inside a group, we could use, e.g.,
2201
2202 $x = "aaaa";
2203 $count = 0; # initialize 'a' count
2204 $c = "bob"; # test if $c gets clobbered
2205 $x =~ /(?{local $c = 0;}) # initialize count
2206 ( a # match 'a'
2207 (?{local $c = $c + 1;}) # increment count
2208 )* # do this any number of times,
2209 aa # but match 'aa' at the end
2210 (?{$count = $c;}) # copy local $c var into $count
2211 /x;
2212 print "'a' count is $count, \$c variable is '$c'\n";
2213
2214This prints
2215
2216 'a' count is 2, $c variable is 'bob'
2217
2218If we replace the S<C< (?{local $c = $c + 1;})> > with
2219S<C< (?{$c = $c + 1;})> >, the variable changes are I<not> undone
2220during backtracking, and we get
2221
2222 'a' count is 4, $c variable is 'bob'
2223
2224Note that only localized variable changes are undone. Other side
2225effects of code expression execution are permanent. Thus
2226
2227 $x = "aaaa";
2228 $x =~ /(a(?{print "Yow\n";}))*aa/;
2229
2230produces
2231
2232 Yow
2233 Yow
2234 Yow
2235 Yow
2236
2237The result C<$^R> is automatically localized, so that it will behave
2238properly in the presence of backtracking.
2239
2240This example uses a code expression in a conditional to match the
2241article 'the' in either English or German:
2242
47f9c88b 2243 $lang = 'DE'; # use German
2244 ...
2245 $text = "das";
2246 print "matched\n"
2247 if $text =~ /(?(?{
2248 $lang eq 'EN'; # is the language English?
2249 })
2250 the | # if so, then match 'the'
2251 (die|das|der) # else, match 'die|das|der'
2252 )
2253 /xi;
2254
2255Note that the syntax here is C<(?(?{...})yes-regexp|no-regexp)>, not
2256C<(?((?{...}))yes-regexp|no-regexp)>. In other words, in the case of a
2257code expression, we don't need the extra parentheses around the
2258conditional.
2259
a6b2f353 2260If you try to use code expressions with interpolating variables, perl
2261may surprise you:
2262
2263 $bar = 5;
2264 $pat = '(?{ 1 })';
2265 /foo(?{ $bar })bar/; # compiles ok, $bar not interpolated
2266 /foo(?{ 1 })$bar/; # compile error!
2267 /foo${pat}bar/; # compile error!
2268
2269 $pat = qr/(?{ $foo = 1 })/; # precompile code regexp
2270 /foo${pat}bar/; # compiles ok
2271
2272If a regexp has (1) code expressions and interpolating variables,or
2273(2) a variable that interpolates a code expression, perl treats the
2274regexp as an error. If the code expression is precompiled into a
2275variable, however, interpolating is ok. The question is, why is this
2276an error?
2277
2278The reason is that variable interpolation and code expressions
2279together pose a security risk. The combination is dangerous because
2280many programmers who write search engines often take user input and
2281plug it directly into a regexp:
47f9c88b 2282
2283 $regexp = <>; # read user-supplied regexp
2284 $chomp $regexp; # get rid of possible newline
2285 $text =~ /$regexp/; # search $text for the $regexp
2286
a6b2f353 2287If the C<$regexp> variable contains a code expression, the user could
2288then execute arbitrary Perl code. For instance, some joker could
47f9c88b 2289search for S<C<system('rm -rf *');> > to erase your files. In this
2290sense, the combination of interpolation and code expressions B<taints>
2291your regexp. So by default, using both interpolation and code
a6b2f353 2292expressions in the same regexp is not allowed. If you're not
2293concerned about malicious users, it is possible to bypass this
2294security check by invoking S<C<use re 'eval'> >:
2295
2296 use re 'eval'; # throw caution out the door
2297 $bar = 5;
2298 $pat = '(?{ 1 })';
2299 /foo(?{ 1 })$bar/; # compiles ok
2300 /foo${pat}bar/; # compiles ok
47f9c88b 2301
2302Another form of code expression is the S<B<pattern code expression> >.
2303The pattern code expression is like a regular code expression, except
2304that the result of the code evaluation is treated as a regular
2305expression and matched immediately. A simple example is
2306
2307 $length = 5;
2308 $char = 'a';
2309 $x = 'aaaaabb';
2310 $x =~ /(??{$char x $length})/x; # matches, there are 5 of 'a'
2311
2312
2313This final example contains both ordinary and pattern code
2314expressions. It detects if a binary string C<1101010010001...> has a
2315Fibonacci spacing 0,1,1,2,3,5,... of the C<1>'s:
2316
47f9c88b 2317 $s0 = 0; $s1 = 1; # initial conditions
2318 $x = "1101010010001000001";
2319 print "It is a Fibonacci sequence\n"
2320 if $x =~ /^1 # match an initial '1'
2321 (
2322 (??{'0' x $s0}) # match $s0 of '0'
2323 1 # and then a '1'
2324 (?{
2325 $largest = $s0; # largest seq so far
2326 $s2 = $s1 + $s0; # compute next term
2327 $s0 = $s1; # in Fibonacci sequence
2328 $s1 = $s2;
2329 })
2330 )+ # repeat as needed
2331 $ # that is all there is
2332 /x;
2333 print "Largest sequence matched was $largest\n";
2334
2335This prints
2336
2337 It is a Fibonacci sequence
2338 Largest sequence matched was 5
2339
2340Ha! Try that with your garden variety regexp package...
2341
2342Note that the variables C<$s0> and C<$s1> are not substituted when the
2343regexp is compiled, as happens for ordinary variables outside a code
2344expression. Rather, the code expressions are evaluated when perl
2345encounters them during the search for a match.
2346
2347The regexp without the C<//x> modifier is
2348
2349 /^1((??{'0'x$s0})1(?{$largest=$s0;$s2=$s1+$s0$s0=$s1;$s1=$s2;}))+$/;
2350
2351and is a great start on an Obfuscated Perl entry :-) When working with
2352code and conditional expressions, the extended form of regexps is
2353almost necessary in creating and debugging regexps.
2354
2355=head2 Pragmas and debugging
2356
2357Speaking of debugging, there are several pragmas available to control
2358and debug regexps in Perl. We have already encountered one pragma in
2359the previous section, S<C<use re 'eval';> >, that allows variable
a6b2f353 2360interpolation and code expressions to coexist in a regexp. The other
2361pragmas are
47f9c88b 2362
2363 use re 'taint';
2364 $tainted = <>;
2365 @parts = ($tainted =~ /(\w+)\s+(\w+)/; # @parts is now tainted
2366
2367The C<taint> pragma causes any substrings from a match with a tainted
2368variable to be tainted as well. This is not normally the case, as
2369regexps are often used to extract the safe bits from a tainted
2370variable. Use C<taint> when you are not extracting safe bits, but are
2371performing some other processing. Both C<taint> and C<eval> pragmas
a6b2f353 2372are lexically scoped, which means they are in effect only until
47f9c88b 2373the end of the block enclosing the pragmas.
2374
2375 use re 'debug';
2376 /^(.*)$/s; # output debugging info
2377
2378 use re 'debugcolor';
2379 /^(.*)$/s; # output debugging info in living color
2380
2381The global C<debug> and C<debugcolor> pragmas allow one to get
2382detailed debugging info about regexp compilation and
2383execution. C<debugcolor> is the same as debug, except the debugging
2384information is displayed in color on terminals that can display
2385termcap color sequences. Here is example output:
2386
2387 % perl -e 'use re "debug"; "abc" =~ /a*b+c/;'
2388 Compiling REx `a*b+c'
2389 size 9 first at 1
2390 1: STAR(4)
2391 2: EXACT <a>(0)
2392 4: PLUS(7)
2393 5: EXACT <b>(0)
2394 7: EXACT <c>(9)
2395 9: END(0)
2396 floating `bc' at 0..2147483647 (checking floating) minlen 2
2397 Guessing start of match, REx `a*b+c' against `abc'...
2398 Found floating substr `bc' at offset 1...
2399 Guessed: match at offset 0
2400 Matching REx `a*b+c' against `abc'
2401 Setting an EVAL scope, savestack=3
2402 0 <> <abc> | 1: STAR
2403 EXACT <a> can match 1 times out of 32767...
2404 Setting an EVAL scope, savestack=3
2405 1 <a> <bc> | 4: PLUS
2406 EXACT <b> can match 1 times out of 32767...
2407 Setting an EVAL scope, savestack=3
2408 2 <ab> <c> | 7: EXACT <c>
2409 3 <abc> <> | 9: END
2410 Match successful!
2411 Freeing REx: `a*b+c'
2412
2413If you have gotten this far into the tutorial, you can probably guess
2414what the different parts of the debugging output tell you. The first
2415part
2416
2417 Compiling REx `a*b+c'
2418 size 9 first at 1
2419 1: STAR(4)
2420 2: EXACT <a>(0)
2421 4: PLUS(7)
2422 5: EXACT <b>(0)
2423 7: EXACT <c>(9)
2424 9: END(0)
2425
2426describes the compilation stage. C<STAR(4)> means that there is a
2427starred object, in this case C<'a'>, and if it matches, goto line 4,
2428i.e., C<PLUS(7)>. The middle lines describe some heuristics and
2429optimizations performed before a match:
2430
2431 floating `bc' at 0..2147483647 (checking floating) minlen 2
2432 Guessing start of match, REx `a*b+c' against `abc'...
2433 Found floating substr `bc' at offset 1...
2434 Guessed: match at offset 0
2435
2436Then the match is executed and the remaining lines describe the
2437process:
2438
2439 Matching REx `a*b+c' against `abc'
2440 Setting an EVAL scope, savestack=3
2441 0 <> <abc> | 1: STAR
2442 EXACT <a> can match 1 times out of 32767...
2443 Setting an EVAL scope, savestack=3
2444 1 <a> <bc> | 4: PLUS
2445 EXACT <b> can match 1 times out of 32767...
2446 Setting an EVAL scope, savestack=3
2447 2 <ab> <c> | 7: EXACT <c>
2448 3 <abc> <> | 9: END
2449 Match successful!
2450 Freeing REx: `a*b+c'
2451
2452Each step is of the form S<C<< n <x> <y> >> >, with C<< <x> >> the
2453part of the string matched and C<< <y> >> the part not yet
2454matched. The S<C<< | 1: STAR >> > says that perl is at line number 1
2455n the compilation list above. See
2456L<perldebguts/"Debugging regular expressions"> for much more detail.
2457
2458An alternative method of debugging regexps is to embed C<print>
2459statements within the regexp. This provides a blow-by-blow account of
2460the backtracking in an alternation:
2461
2462 "that this" =~ m@(?{print "Start at position ", pos, "\n";})
2463 t(?{print "t1\n";})
2464 h(?{print "h1\n";})
2465 i(?{print "i1\n";})
2466 s(?{print "s1\n";})
2467 |
2468 t(?{print "t2\n";})
2469 h(?{print "h2\n";})
2470 a(?{print "a2\n";})
2471 t(?{print "t2\n";})
2472 (?{print "Done at position ", pos, "\n";})
2473 @x;
2474
2475prints
2476
2477 Start at position 0
2478 t1
2479 h1
2480 t2
2481 h2
2482 a2
2483 t2
2484 Done at position 4
2485
2486=head1 BUGS
2487
2488Code expressions, conditional expressions, and independent expressions
2489are B<experimental>. Don't use them in production code. Yet.
2490
2491=head1 SEE ALSO
2492
2493This is just a tutorial. For the full story on perl regular
2494expressions, see the L<perlre> regular expressions reference page.
2495
2496For more information on the matching C<m//> and substitution C<s///>
2497operators, see L<perlop/"Regexp Quote-Like Operators">. For
2498information on the C<split> operation, see L<perlfunc/split>.
2499
2500For an excellent all-around resource on the care and feeding of
2501regular expressions, see the book I<Mastering Regular Expressions> by
2502Jeffrey Friedl (published by O'Reilly, ISBN 1556592-257-3).
2503
2504=head1 AUTHOR AND COPYRIGHT
2505
2506Copyright (c) 2000 Mark Kvale
2507All rights reserved.
2508
2509This document may be distributed under the same terms as Perl itself.
2510
2511=head2 Acknowledgments
2512
2513The inspiration for the stop codon DNA example came from the ZIP
2514code example in chapter 7 of I<Mastering Regular Expressions>.
2515
a6b2f353 2516The author would like to thank Jeff Pinyan, Andrew Johnson, Peter
2517Haworth, Ronald J Kimball, and Joe Smith for all their helpful
2518comments.
47f9c88b 2519
2520=cut
a6b2f353 2521